ID: 950441099

View in Genome Browser
Species Human (GRCh38)
Location 3:13010953-13010975
Sequence CACTAGAGCTTGCCTCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 130}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950441091_950441099 17 Left 950441091 3:13010913-13010935 CCCAAACTCTCCTCCACTCCCCA 0: 1
1: 0
2: 5
3: 63
4: 611
Right 950441099 3:13010953-13010975 CACTAGAGCTTGCCTCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 130
950441093_950441099 7 Left 950441093 3:13010923-13010945 CCTCCACTCCCCACTTGAGCAGT 0: 1
1: 0
2: 1
3: 20
4: 238
Right 950441099 3:13010953-13010975 CACTAGAGCTTGCCTCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 130
950441090_950441099 30 Left 950441090 3:13010900-13010922 CCTACAGTTTCTACCCAAACTCT 0: 1
1: 0
2: 2
3: 33
4: 309
Right 950441099 3:13010953-13010975 CACTAGAGCTTGCCTCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 130
950441094_950441099 4 Left 950441094 3:13010926-13010948 CCACTCCCCACTTGAGCAGTGCC 0: 1
1: 0
2: 1
3: 30
4: 198
Right 950441099 3:13010953-13010975 CACTAGAGCTTGCCTCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 130
950441096_950441099 -2 Left 950441096 3:13010932-13010954 CCCACTTGAGCAGTGCCTGCTCA 0: 1
1: 0
2: 0
3: 6
4: 111
Right 950441099 3:13010953-13010975 CACTAGAGCTTGCCTCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 130
950441092_950441099 16 Left 950441092 3:13010914-13010936 CCAAACTCTCCTCCACTCCCCAC 0: 1
1: 0
2: 8
3: 100
4: 956
Right 950441099 3:13010953-13010975 CACTAGAGCTTGCCTCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 130
950441097_950441099 -3 Left 950441097 3:13010933-13010955 CCACTTGAGCAGTGCCTGCTCAC 0: 1
1: 0
2: 0
3: 10
4: 171
Right 950441099 3:13010953-13010975 CACTAGAGCTTGCCTCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 130
950441095_950441099 -1 Left 950441095 3:13010931-13010953 CCCCACTTGAGCAGTGCCTGCTC 0: 1
1: 0
2: 0
3: 13
4: 208
Right 950441099 3:13010953-13010975 CACTAGAGCTTGCCTCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950441099 Original CRISPR CACTAGAGCTTGCCTCCTCC TGG Intronic
902286842 1:15412615-15412637 CCCCAGAGCCTGCCTTCTCCTGG + Intronic
902997026 1:20233940-20233962 GACTAGAGCTTGCATTCCCCCGG + Intergenic
903672814 1:25046569-25046591 GCCTAGAGCTGGCCTCCTTCAGG + Intergenic
904801398 1:33095185-33095207 CACTAGAGGTCGCCTCTTCTTGG + Intronic
907319102 1:53591774-53591796 CACTTGGTCTTGCCTCTTCCAGG - Intronic
907509769 1:54949496-54949518 CACTAGAACTTTGCTCCTCAAGG - Intergenic
907617310 1:55938216-55938238 CACTAGTGCTGGCCTCCTGGAGG + Intergenic
911819032 1:102392693-102392715 CACCAGAGTTTGTCTCCTTCAGG - Intergenic
912547114 1:110458711-110458733 GACAAGAACTTGCCTCATCCAGG - Intergenic
918181065 1:182086370-182086392 CACCCGAGCTTTCCTCCCCCGGG - Intergenic
918366465 1:183813091-183813113 CACTAAAGAAAGCCTCCTCCTGG - Intronic
920950021 1:210563763-210563785 TACTTGGGCTGGCCTCCTCCAGG + Intronic
923360035 1:233202019-233202041 GACTAGAGCTTTCCTCCTCCAGG - Intronic
1063179406 10:3584294-3584316 CACCAGAACTTGCATCCTGCAGG + Intergenic
1065509341 10:26462951-26462973 AACTAGAGCAAGCCTCCTTCTGG + Intronic
1069119887 10:64556547-64556569 CACTAGGTATTCCCTCCTCCAGG + Intergenic
1069893149 10:71664442-71664464 CCCTAGAGCATCCCTCCTGCAGG + Intronic
1070561046 10:77566735-77566757 CACCTGGGCTTGCCTCCACCCGG - Intronic
1070637231 10:78139368-78139390 CCCTAGGGCCTGCTTCCTCCCGG + Intergenic
1073212908 10:101818980-101819002 CTATAGAGCTTGCCTCGTGCTGG + Intergenic
1076627426 10:131830675-131830697 CACTGCAGCTTGGCTCATCCCGG + Intergenic
1077047656 11:553505-553527 CACTGCAGCTCCCCTCCTCCTGG - Intronic
1077456462 11:2684364-2684386 CACTGGAGCTTGTCTCATGCTGG - Intronic
1078519305 11:12050721-12050743 CACAAGAGTTTCCCTCCTCTTGG + Intergenic
1081576237 11:44320002-44320024 CTCCGGAGCTTGCTTCCTCCGGG - Intergenic
1082000120 11:47389617-47389639 TTCAAGGGCTTGCCTCCTCCAGG + Intergenic
1082961518 11:58922581-58922603 CATTTGAGCTTGACTCCTCAGGG + Intronic
1083157376 11:60832505-60832527 CCCTTTAACTTGCCTCCTCCAGG + Intergenic
1083200795 11:61119855-61119877 GAAGAGACCTTGCCTCCTCCTGG - Intronic
1089495904 11:118908622-118908644 CCCTGGAGCTTCTCTCCTCCTGG + Exonic
1090094656 11:123730705-123730727 CTCTAGGGCTTGCTGCCTCCTGG + Exonic
1098007240 12:66010547-66010569 CATTAGAGATTTCCTACTCCTGG + Intergenic
1099607687 12:84826591-84826613 CACTAGATGTTGCCTCTGCCTGG - Intergenic
1100282100 12:93127818-93127840 CACTAAAGCTTGTCTCCGCCAGG - Intergenic
1101124192 12:101614227-101614249 CACTACACCATGCCACCTCCTGG + Intronic
1107628225 13:42313396-42313418 CAAAAGAGCTTGCTTCCTACAGG + Intronic
1114551879 14:23537513-23537535 CATTGTAGCTTCCCTCCTCCTGG + Intronic
1115761451 14:36581768-36581790 CACCAGCGCCGGCCTCCTCCAGG + Intronic
1117990414 14:61427440-61427462 AACTAGATCTTTCCTCTTCCAGG - Intronic
1119520214 14:75279423-75279445 AACTAGAGCCTGGCTTCTCCGGG + Intronic
1121410865 14:93747246-93747268 CACTTGACCTCCCCTCCTCCTGG - Intronic
1121449862 14:94000462-94000484 CATGAGAGGTCGCCTCCTCCAGG - Intergenic
1122544388 14:102514246-102514268 CACTCCAGCCGGCCTCCTCCAGG - Intergenic
1123759220 15:23419821-23419843 CAGCAGAGCTTGTTTCCTCCAGG - Intergenic
1130199123 15:81808848-81808870 CACCAGAACTTGCATCCTCAGGG - Intergenic
1133405865 16:5523947-5523969 CCCCAGCGCTTGCCTCCTCCCGG + Intergenic
1134457126 16:14403034-14403056 CAGTAGAGCTTGGTTCCTCCAGG + Intergenic
1135145535 16:19959588-19959610 CATAGGAGCTTGGCTCCTCCTGG - Intergenic
1135410437 16:22230109-22230131 CACTTGAGCTGTCCTCCTCGGGG - Intronic
1136139767 16:28281300-28281322 CACCCCAGCCTGCCTCCTCCGGG + Intergenic
1136456533 16:30382683-30382705 CACTTGGGGTTGCCACCTCCTGG + Intronic
1138457344 16:57129011-57129033 GCTTAGAGCTTGCCCCCTCCAGG - Intronic
1138516796 16:57540593-57540615 CACTGGATCCTGCCTCCTCCAGG - Intergenic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142849745 17:2698630-2698652 CACAAGAGCCTGCATCCACCTGG + Intronic
1142955841 17:3521203-3521225 CACTGGATCCTGCCTCCTCCAGG + Intronic
1144503384 17:15808485-15808507 CACTAGGCCTTGGCTCATCCTGG - Intergenic
1145165563 17:20611192-20611214 CACTAGGCCTTGGCTCATCCTGG - Intergenic
1145998288 17:29116958-29116980 ACCTAGAGCCTGGCTCCTCCTGG + Intronic
1147214360 17:38890755-38890777 CCCTAAAGCCTACCTCCTCCAGG + Intronic
1148602166 17:48902553-48902575 CACTAGATATGACCTCCTCCTGG - Intergenic
1148875117 17:50682623-50682645 TACTAAAGTCTGCCTCCTCCAGG + Intronic
1149497119 17:57126070-57126092 CTCCAGAGCTGGCCTCGTCCAGG + Intergenic
1149774388 17:59345863-59345885 CAATAGAGCCTACCTCCTGCAGG - Intronic
1151933528 17:77247757-77247779 CATTAGATGTCGCCTCCTCCAGG + Intergenic
1152503248 17:80726993-80727015 CACTTGAGCACGCTTCCTCCTGG - Intronic
1155540993 18:26868050-26868072 CACCAGAGCTTCCCACCTCCTGG - Intergenic
1159115787 18:64111648-64111670 CCCTAAGGTTTGCCTCCTCCAGG - Intergenic
1165494062 19:36141659-36141681 CATTAGGTCTTGCTTCCTCCTGG - Intronic
1165708758 19:37994873-37994895 CCATGGAGCTTGTCTCCTCCAGG - Intronic
925329899 2:3050451-3050473 CACCAACGCTTCCCTCCTCCAGG + Intergenic
927153964 2:20211313-20211335 AACGAGCTCTTGCCTCCTCCAGG - Intronic
928049372 2:27973464-27973486 CACTAGAGCTTGCCTGCCTTAGG - Intronic
932890093 2:75587086-75587108 AACTAGAGCATGCATCCACCTGG + Intergenic
933482565 2:82875905-82875927 CACTCTAGCCTGCCTGCTCCAGG + Intergenic
933841010 2:86285630-86285652 CAACAGAGCCTGCCTTCTCCCGG + Intronic
937160316 2:119754939-119754961 CCCTAGAGCCTGCCTCCTCAAGG + Intergenic
939257985 2:139769680-139769702 GACTAGTGCTTCCCTCTTCCTGG + Intergenic
943726500 2:191256786-191256808 CACTAGAGCAGGCCTACCCCTGG - Intronic
944949308 2:204728906-204728928 TTCTAGAGCCTGGCTCCTCCTGG - Intronic
946156938 2:217813238-217813260 CCCTTGAGCTTGACTCCTCTGGG + Exonic
946784581 2:223229345-223229367 CACTAGAAGTTGGCTCTTCCTGG + Intergenic
947792671 2:232876914-232876936 CCCTAGCGCTTACCTCCTCACGG - Intronic
1171463008 20:25309413-25309435 CACTAAAGGCTGCCTCCTGCTGG + Intronic
1174393032 20:50229563-50229585 CGCCAGAGACTGCCTCCTCCAGG + Intergenic
1175287093 20:57844283-57844305 CTCTCCAGCTTGCCTCGTCCAGG + Intergenic
1176887462 21:14273810-14273832 CTCCACACCTTGCCTCCTCCAGG + Intergenic
1182876855 22:33699441-33699463 CTGTGGAGCTGGCCTCCTCCTGG - Intronic
1183987383 22:41577010-41577032 TACTTGAGCACGCCTCCTCCTGG + Exonic
1184477117 22:44727904-44727926 GTCTAGATGTTGCCTCCTCCAGG - Intronic
1184691538 22:46119515-46119537 CACTGGAGGGTGCCTCCCCCCGG - Intergenic
1185346616 22:50313368-50313390 CTCCAGACCTTCCCTCCTCCGGG + Intronic
950441099 3:13010953-13010975 CACTAGAGCTTGCCTCCTCCTGG + Intronic
950484631 3:13265789-13265811 CACTATTGCTTACCTCCTACTGG + Intergenic
956745740 3:72309798-72309820 CACTCGGGCTTGCCTACTTCAGG - Intergenic
958451329 3:94276803-94276825 CACTACAACTTTCCACCTCCTGG - Intergenic
967462450 3:189762151-189762173 AACTAGATCTTTCCTCTTCCAGG - Intronic
967860457 3:194147587-194147609 CGCTTAAGCTTGCCTCCCCCCGG + Intergenic
968594018 4:1473181-1473203 CCCTAGTGGCTGCCTCCTCCTGG - Intergenic
968758570 4:2429143-2429165 CACTAGCTGTTGCCTCCACCTGG + Intronic
969494729 4:7520041-7520063 CACCAGGGCTCTCCTCCTCCAGG - Intronic
969718188 4:8878440-8878462 CACCAGAGCATCCATCCTCCAGG - Intergenic
972589420 4:40470315-40470337 CAGTATAGCTTTCCTCCTACTGG - Intronic
972848580 4:43020111-43020133 TCCTGGAGCTTGCCTCCTGCTGG + Intronic
976207349 4:82635714-82635736 TACTAGCACTTACCTCCTCCTGG - Intronic
979776378 4:124593311-124593333 CACCTGAGATTGCCTCATCCTGG - Intergenic
983160595 4:164409077-164409099 CACTGGAGGTTTCCTCTTCCTGG + Intergenic
983575556 4:169257504-169257526 CACTACAGCTTCCCCCATCCAGG + Intronic
984002292 4:174264381-174264403 GACTAGAGCATGCCTTCTTCTGG + Intronic
987211260 5:15685979-15686001 TACTGGAGCTTGTCTCCCCCCGG - Intronic
991903021 5:71479327-71479349 CACTGCACCTGGCCTCCTCCTGG + Intronic
995528370 5:113068678-113068700 CACGACAGCTGGCCTGCTCCGGG - Intronic
999180094 5:149663938-149663960 AACTGGAGCTTGCCGACTCCTGG - Intergenic
1000272995 5:159704560-159704582 CTCTAGGGCTTGCCCCTTCCTGG - Intergenic
1001031939 5:168269484-168269506 CACCAGCCCTCGCCTCCTCCCGG + Intergenic
1002854774 6:1027115-1027137 GACTTGAGCTTGACTTCTCCAGG + Intergenic
1003309428 6:4956693-4956715 CCCTAGAGCTTCCCAGCTCCTGG + Intergenic
1005357709 6:25000203-25000225 CATTAGAGGTTGCTTCCTCCAGG + Intronic
1013825876 6:114210917-114210939 CACTATATCTTACCTCCTCCAGG + Intronic
1018010583 6:159666425-159666447 CACTGCAGCTTGGCTCTTCCTGG + Intergenic
1022108885 7:27215686-27215708 CAGTAGAGAATCCCTCCTCCAGG - Intergenic
1022351156 7:29566671-29566693 CAGGAAAGCCTGCCTCCTCCGGG - Exonic
1027054899 7:75043152-75043174 CACCAGCGCCTGTCTCCTCCGGG - Intronic
1027513726 7:79115047-79115069 AAGTAGAGCTGCCCTCCTCCTGG - Intronic
1032006916 7:128309739-128309761 CACTAGTTGTCGCCTCCTCCTGG - Exonic
1033760511 7:144432073-144432095 CACTAAAGCTTTGCTCTTCCTGG + Intergenic
1034056684 7:148042652-148042674 CACTAGACCATACCACCTCCTGG + Intronic
1034468441 7:151243386-151243408 CCCTAGCTCTTGCCCCCTCCTGG + Intronic
1037913985 8:22761009-22761031 CCCTAGAGCTCGCTTCCTCTGGG - Intronic
1042206445 8:66334330-66334352 CAGGAGGGCTGGCCTCCTCCTGG + Intergenic
1045413202 8:101940678-101940700 ACCTAGAGCTTGTCTCCTTCTGG - Intronic
1046648114 8:116807446-116807468 CAGTAAGGCTTGCCTTCTCCAGG + Intronic
1047142983 8:122162891-122162913 GACTATAACTTGCCTCCTCCTGG - Intergenic
1055376846 9:75657840-75657862 CACTAGAGATTTCCTCCCCTTGG - Intergenic
1057243834 9:93437189-93437211 CACTGGAGCTGGCATCTTCCTGG + Intergenic
1058836300 9:108861168-108861190 CAGGAGAGCTTGGCTACTCCTGG + Intergenic
1061825653 9:133256751-133256773 CCCTAGAGCTTCCTCCCTCCAGG + Intronic
1192739067 X:73875746-73875768 CACAAGTTCTTGCCTTCTCCTGG - Intergenic
1192849824 X:74942904-74942926 CACTAGTGCTGGTCTGCTCCAGG + Intergenic
1194638115 X:96370421-96370443 AACTAGATCTTGCCTCTTTCTGG - Intergenic
1197930982 X:131696093-131696115 AACTAGATCTTTCCTCTTCCAGG - Intergenic
1199987812 X:152964914-152964936 GCCTAGAGGTTGCCTCATCCTGG - Intronic