ID: 950441800

View in Genome Browser
Species Human (GRCh38)
Location 3:13014886-13014908
Sequence GCTCCTGGGGGGACACATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950441789_950441800 27 Left 950441789 3:13014836-13014858 CCACTCTGGATCATTTCAGAAAG 0: 1
1: 0
2: 1
3: 23
4: 194
Right 950441800 3:13014886-13014908 GCTCCTGGGGGGACACATACTGG 0: 1
1: 0
2: 0
3: 15
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950441800 Original CRISPR GCTCCTGGGGGGACACATAC TGG Intronic
900545686 1:3227830-3227852 GCTCCTGTGGGGACAGGTGCTGG + Intronic
901081340 1:6585908-6585930 TCTCCTGGCAGGAAACATACTGG + Exonic
903017876 1:20373448-20373470 GCTCCTGGGGGGACAGGTTTGGG + Intergenic
910860983 1:91742114-91742136 ACTCCTGGGAGGACACAGAACGG - Intronic
912430419 1:109625706-109625728 TCTCCTCGGGGAACTCATACGGG - Exonic
912820732 1:112865716-112865738 GCTACTTGGGGGGCAGATACAGG - Intergenic
914447273 1:147760539-147760561 CCTCCTGGGAGAACACAGACAGG - Intronic
918014288 1:180617929-180617951 GCTCCTGGGTGGTCACAAGCTGG + Intergenic
921406107 1:214781234-214781256 TCTCCTTGGGGGACAAATATAGG + Intergenic
924944570 1:248837965-248837987 GCCGCTGGCGGGACACAGACAGG - Intergenic
1067467650 10:46513001-46513023 GCTCCTATGGGGACAGATTCTGG - Intergenic
1067619536 10:47871604-47871626 GCTCCTATGGGGACAGATTCTGG + Intergenic
1068736371 10:60417677-60417699 ACTACTGGAGGGACACAGACTGG + Intronic
1073814767 10:107194615-107194637 GTTTCTGGGGTGACACAAACAGG - Intergenic
1076004647 10:126938956-126938978 ACACCTGGGGGGACAAACACCGG + Intronic
1077035102 11:490638-490660 GCTCCTGGTGGGACTCACACAGG - Exonic
1081831843 11:46121285-46121307 CCTCCAGGAGGGACACACACAGG + Intergenic
1083088509 11:60175695-60175717 CCTCCTGAGGGGACAGATAAGGG - Intronic
1087066267 11:94030822-94030844 GCTCCTGGGTAGACACATGCAGG + Intronic
1090227618 11:125081264-125081286 CCTCCTGCTGGGACACACACTGG + Intronic
1094437052 12:30432203-30432225 GCTACTGTGGAGACACATAGGGG - Intergenic
1096757787 12:53814607-53814629 TCTCCTGGAGGGACAGTTACAGG - Intergenic
1100952464 12:99866709-99866731 AGTCCTGGGGGAACAAATACTGG - Intronic
1101603587 12:106231481-106231503 GCAGCTGGGAGGAGACATACAGG - Intergenic
1103979550 12:124727565-124727587 GCTGCTGGGAGGACACAGGCAGG - Intergenic
1105209165 13:18247735-18247757 GCTGCAGGGAGGACACATACAGG - Intergenic
1106575994 13:30976257-30976279 GCTGCTGGTGGGAAACCTACAGG - Intergenic
1107087571 13:36442617-36442639 GCTCCATGAGGGACACACACAGG - Exonic
1110282852 13:73715367-73715389 GCTCACCGGAGGACACATACAGG - Exonic
1112330279 13:98472065-98472087 GCCACTGGAGGGACACACACAGG + Intronic
1112502816 13:99955744-99955766 GCTCCTGGGGGAACCCAGGCCGG + Intergenic
1113402351 13:110005561-110005583 GCTCTGGGTGGGGCACATACAGG + Intergenic
1116738596 14:48726676-48726698 GCTCCTGGGGAGAAATATCCAGG - Intergenic
1118930705 14:70237644-70237666 TCTCCAGGGGGCACACAAACAGG - Intergenic
1124162926 15:27290548-27290570 GGTCCTGGGGGGATACACAGAGG - Intronic
1126753798 15:51904584-51904606 GCTCCTGGAGGGACAGCTGCTGG - Intronic
1127300192 15:57645261-57645283 GTTCCTTGGGGGAAACAAACTGG + Intronic
1128251375 15:66166379-66166401 GCTCCTGGGGTGACAGATGCTGG - Intronic
1130402527 15:83571092-83571114 TCTTTTGGGGGGCCACATACTGG + Intronic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133899407 16:9959380-9959402 GCTCCTATGGGGAGACATGCAGG - Intronic
1136568366 16:31082952-31082974 GCTCCTGGGGGGAGAGAGAGAGG - Exonic
1137727236 16:50665194-50665216 GCTCCTGGGGGCGCTGATACTGG + Intergenic
1140457830 16:75115038-75115060 GCTGCTGGGGGGACACCCGCGGG - Intronic
1141284925 16:82662774-82662796 CCTCCCAGAGGGACACATACTGG - Intronic
1141744731 16:85918369-85918391 GGTGCTGCGGGGAGACATACAGG - Intronic
1142067656 16:88072050-88072072 GCACCTGGAGGGAGACACACGGG - Exonic
1142764237 17:2056652-2056674 TCTCCTGCGGGGACACACACCGG - Exonic
1142850705 17:2703474-2703496 TCTCCTGGGGGGACACCTGCAGG + Exonic
1143676446 17:8436238-8436260 GCCCCTGGGGGGCCACACATCGG - Intronic
1147137096 17:38440760-38440782 GATCCCGGTGGGACACACACTGG - Intronic
1151976386 17:77485758-77485780 GCTCCTGGGAGGACAGAGGCTGG - Intronic
1158261341 18:55609301-55609323 GCTGCTGGGAAGACTCATACGGG + Intronic
1162234438 19:9296244-9296266 GTACATGGGAGGACACATACTGG - Exonic
926146150 2:10398166-10398188 GCTCCCGGGGGGACACCTGGGGG + Intronic
927899567 2:26809485-26809507 TATCCTGGGGTGACACATTCTGG - Intergenic
928764546 2:34627950-34627972 GATCCTGGGGGGACAATCACTGG - Intergenic
931285030 2:60824894-60824916 CCACCTGGGGGGACAGGTACTGG + Intergenic
932759534 2:74430316-74430338 GCAGCTGGGGGAACACATCCAGG - Exonic
934560918 2:95312914-95312936 CCTCCTTGCGGGACACACACGGG - Intronic
940855301 2:158724600-158724622 TCTCCTGGACGGACACACACAGG + Intergenic
943137155 2:183928256-183928278 TCTCCTGGAGGGAAACAGACAGG - Intergenic
944076701 2:195740481-195740503 GCTCCTGGGGAAATAAATACAGG - Intronic
948494627 2:238339449-238339471 GCGCCTGGGGGGAAACACCCAGG + Intronic
948497081 2:238357753-238357775 GAGCCTGGAGGGACACATTCAGG - Intronic
1171290338 20:23979448-23979470 GCTGCAGGGAGGACACATACAGG - Intergenic
1173107456 20:40151209-40151231 ACTCCTGGGGGGACAAACATGGG + Intergenic
1173204738 20:40983858-40983880 ACTGCTGGGTGGACACAAACTGG - Intergenic
1173374646 20:42472416-42472438 GCTGCTGGTTGAACACATACTGG + Exonic
1175864031 20:62165089-62165111 GCTCCTGGGAGGACGCAGGCAGG - Intronic
1177609635 21:23430431-23430453 GCTTCTTGGGGGACACATTTCGG - Intergenic
1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG + Intronic
1179462518 21:41547257-41547279 GCTCTTGGGGGTGCACAGACAGG + Intergenic
1180767091 22:18351562-18351584 GCTGCAGGGAGGACACACACAGG + Intergenic
1180811939 22:18768137-18768159 GCTGCAGGGAGGACACACACAGG - Intergenic
1181198094 22:21202381-21202403 GCTGCAGGGAGGACACACACAGG - Intergenic
1181401650 22:22653423-22653445 GCTGCAGGGAGGACACATACAGG + Intergenic
1181703608 22:24634520-24634542 GCTGCAGGGAGGACACATACAGG + Intergenic
1183274822 22:36887596-36887618 TCTCCTGAGGGGACACATTAAGG + Intergenic
1203228713 22_KI270731v1_random:92456-92478 GCTGCAGGGAGGACACACACAGG + Intergenic
950441800 3:13014886-13014908 GCTCCTGGGGGGACACATACTGG + Intronic
950581466 3:13865097-13865119 GCTCTTAGGGGCACACACACTGG - Intronic
951894377 3:27596962-27596984 CCTTCTGTGGGGACACACACAGG + Intergenic
952312414 3:32201946-32201968 TCTCCTGAAGGGACCCATACTGG + Intergenic
953617050 3:44500514-44500536 GTTCCTGGGGGAACAGAGACTGG - Exonic
955378882 3:58421206-58421228 GCTCCTTTGTGGTCACATACAGG - Intronic
957915484 3:86682849-86682871 ACTCCTGAGGGGAGACATACAGG + Intergenic
959098557 3:101984258-101984280 GTACCTTGGGGGTCACATACTGG - Intergenic
963909930 3:150808123-150808145 GCTTCTGTGGGGTCACAAACAGG - Intergenic
966861197 3:184231610-184231632 GCTCCAGCGGGGAGACAGACAGG - Intronic
970959621 4:21857037-21857059 GCTCCTGGGTGGAAAGACACAGG + Intronic
971038293 4:22720631-22720653 ACTACTGGAGGGACACAGACAGG + Intergenic
972252822 4:37322495-37322517 GCTTCTGGAGGGACATAAACAGG + Intronic
976481880 4:85555865-85555887 GCTCATGGGGGGAAACTGACTGG + Intronic
980839905 4:138245869-138245891 GCTGGTGGGGGGACACAAATTGG + Intergenic
982235892 4:153250742-153250764 GCTCCCTGTGGGAAACATACTGG + Intronic
1004197313 6:13516556-13516578 GCTCATGGGGGCCCACATAAGGG - Intergenic
1009946427 6:70346901-70346923 GGTCCTGGAGGGATACAGACTGG + Intergenic
1013304959 6:108839212-108839234 GCTCCTGGCGGGAGACCCACAGG + Intergenic
1019490768 7:1312231-1312253 GCTCCCGGGGGGCCACATGCCGG + Intergenic
1019496217 7:1341717-1341739 GCTCCTGGGGGGATCCAGGCGGG + Intergenic
1020432846 7:8131045-8131067 GCTCAGGGGTGGACACATGCCGG + Intronic
1023960370 7:44921603-44921625 GCACCTGGGGGAGCACCTACTGG + Intergenic
1025992665 7:66507266-66507288 GCTCCTGAGGGGGCTGATACAGG - Intergenic
1027866036 7:83648491-83648513 GCTCCTGTGGGGTTACTTACTGG - Exonic
1028904907 7:96142141-96142163 GATTCAGGGGGTACACATACAGG + Intronic
1030106519 7:105992077-105992099 GCTCCAAAGGGGATACATACAGG - Intronic
1032565114 7:132933828-132933850 GGTCCTGGGGACACACATACAGG + Intronic
1033722362 7:144075002-144075024 GCTCCTTGGGGCTCTCATACTGG - Exonic
1036341647 8:7920312-7920334 GCTCCTGGAGGCACAGACACTGG + Intergenic
1037342243 8:17858527-17858549 GCTTCTGGGGGTACACATGCAGG - Intergenic
1040546647 8:48403298-48403320 GCTCCTGGAGGCACAAATCCTGG - Intergenic
1049321571 8:141999610-141999632 GCTTCTGGGGGAACCCAAACTGG + Intergenic
1051001439 9:12287291-12287313 GCTTCTTGGGGGAAACCTACAGG + Intergenic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1062158324 9:135066428-135066450 GCAGTTGGGGGGACACATGCAGG + Intergenic
1062158429 9:135066851-135066873 GCATTTGGGGGGACACATGCAGG + Intergenic
1062320363 9:135987915-135987937 GCTCCCAGGGGGACCCATACTGG - Intergenic
1185924900 X:4134773-4134795 GCTCCTGGAGGGTCACTTAATGG - Intergenic
1186128303 X:6439859-6439881 GATTCTGGGGGTACACATGCAGG + Intergenic
1186500376 X:10045948-10045970 GCCCCTCGGAGGACACACACTGG - Intronic
1187873512 X:23783639-23783661 GCTCCTGGGGGGATGCACATAGG - Exonic
1190254658 X:48753577-48753599 ACTCCTGGGGCCACACATACTGG - Intergenic