ID: 950442742

View in Genome Browser
Species Human (GRCh38)
Location 3:13019468-13019490
Sequence GGCCGCCGGCAGCTCCGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 636
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 611}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950442737_950442742 -5 Left 950442737 3:13019450-13019472 CCTCCAATCTGTCCCTGTGGCCG 0: 1
1: 0
2: 1
3: 11
4: 138
Right 950442742 3:13019468-13019490 GGCCGCCGGCAGCTCCGCCTTGG 0: 1
1: 0
2: 0
3: 24
4: 611
950442738_950442742 -8 Left 950442738 3:13019453-13019475 CCAATCTGTCCCTGTGGCCGCCG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 950442742 3:13019468-13019490 GGCCGCCGGCAGCTCCGCCTTGG 0: 1
1: 0
2: 0
3: 24
4: 611
950442734_950442742 6 Left 950442734 3:13019439-13019461 CCGATCGCAACCCTCCAATCTGT 0: 1
1: 0
2: 0
3: 5
4: 66
Right 950442742 3:13019468-13019490 GGCCGCCGGCAGCTCCGCCTTGG 0: 1
1: 0
2: 0
3: 24
4: 611
950442736_950442742 -4 Left 950442736 3:13019449-13019471 CCCTCCAATCTGTCCCTGTGGCC 0: 1
1: 0
2: 2
3: 26
4: 304
Right 950442742 3:13019468-13019490 GGCCGCCGGCAGCTCCGCCTTGG 0: 1
1: 0
2: 0
3: 24
4: 611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950442742 Original CRISPR GGCCGCCGGCAGCTCCGCCT TGG Intronic
900234417 1:1580641-1580663 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
900458629 1:2789658-2789680 GGCGGCCAGCAGCGCCTCCTCGG + Exonic
901601565 1:10426961-10426983 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
902248233 1:15135975-15135997 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
902454267 1:16520918-16520940 GGCCCCAGGCAGCTCGGGCTGGG - Intergenic
903746153 1:25588148-25588170 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
904269278 1:29338726-29338748 GGCCGCAGGGAACTCTGCCTAGG - Intergenic
904272504 1:29359624-29359646 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
904814058 1:33182052-33182074 GGCCACCGGCAGCTCGGATTCGG - Intronic
905762546 1:40572324-40572346 GGCCGCAGGAACCTCTGCCTAGG + Intergenic
905886843 1:41496293-41496315 CGCCGCCTGCAGGTCCGCCGCGG - Intergenic
906545500 1:46616847-46616869 GGGCGACGCCAGCTCCGCCCCGG + Intronic
906998737 1:50827496-50827518 GGCCGCAGGGACCTCTGCCTAGG + Intronic
907159699 1:52361115-52361137 GACCTCCTGCAGCTCCGTCTAGG + Exonic
907281340 1:53349236-53349258 GGCAGCCGACGGCTCCCCCTAGG + Intergenic
907296536 1:53459635-53459657 GGCCGCCTCCTGCTCCTCCTCGG - Exonic
907397315 1:54200283-54200305 GGCTCCGGGCAGCTCGGCCTTGG + Exonic
907465926 1:54636763-54636785 GGCCGCAGGGACCTCTGCCTAGG - Exonic
908543084 1:65140094-65140116 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
908660040 1:66425462-66425484 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
908951375 1:69567303-69567325 GGCGGCCGGGAGCGCCTCCTCGG - Intergenic
909413170 1:75377384-75377406 GGCCGCAGGGACCTCTGCCTAGG + Intronic
909413821 1:75382789-75382811 GGCCGCAGGGACCTCTGCCTAGG + Intronic
909585268 1:77282065-77282087 CGGCGCCTGCAGCTCCGGCTCGG + Exonic
909793425 1:79702640-79702662 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
911010670 1:93277429-93277451 GGCCGCAGGGACCTCTGCCTAGG - Intronic
911188648 1:94927145-94927167 GGCCGCCCCCGCCTCCGCCTGGG + Exonic
912942585 1:114058451-114058473 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
912966912 1:114243595-114243617 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
913191752 1:116418776-116418798 GGCTGCGGGCAGGGCCGCCTGGG - Intergenic
914252431 1:145932731-145932753 GGCCGCAGGGATCTCTGCCTAGG + Intergenic
914293586 1:146297987-146298009 GGCCGGCGGCCGCTCCGACGCGG - Intergenic
914379950 1:147106757-147106779 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
914393174 1:147240394-147240416 GGCCGCAGGGACCTCTGCCTAGG + Intronic
914437068 1:147669938-147669960 GGCCTCCTGCAGCTCGGCCAGGG + Exonic
914554630 1:148748770-148748792 GGCCGGCGGCCGCTCCGACGCGG - Intergenic
914765583 1:150635217-150635239 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
914985765 1:152455760-152455782 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
915401819 1:155627313-155627335 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
915402723 1:155635525-155635547 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
915480219 1:156179521-156179543 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
916048272 1:161017134-161017156 GGCCGCAGGGACCTCTGCCTAGG + Intronic
916092229 1:161316327-161316349 GGCCGCAAGGACCTCCGCCTAGG - Intronic
916222379 1:162457769-162457791 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
916713679 1:167433005-167433027 GGACGCCGGCAGCTCCTACCTGG + Exonic
916756014 1:167771120-167771142 GGCCGCAGGGACCTCTGCCTAGG - Intronic
916759751 1:167805773-167805795 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
917979321 1:180259557-180259579 GGGCGCCAGCAGCTGAGCCTGGG + Intronic
918238439 1:182601602-182601624 GGCCTCAGGCAGGTCAGCCTGGG + Intronic
919520701 1:198583751-198583773 GGCCGCGGGGACCTCTGCCTAGG - Intergenic
920796365 1:209141481-209141503 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
920857653 1:209675869-209675891 GGCGGCCTGCAGCTCCGCCACGG - Exonic
921185337 1:212665386-212665408 GGCTGCTGGCAGGTCTGCCTTGG - Intergenic
922305396 1:224340129-224340151 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
922458347 1:225795720-225795742 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
922702093 1:227767202-227767224 GGAGGCCAGCAGCTCCTCCTTGG - Intronic
922715539 1:227868987-227869009 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
922784322 1:228275633-228275655 CGGTGCCGGCAGCTCTGCCTGGG + Intronic
924624719 1:245688701-245688723 GGCCACCGGCAGCGCGTCCTCGG + Exonic
1065500567 10:26377532-26377554 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1065553726 10:26893768-26893790 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1065636989 10:27743465-27743487 GGCCGCCGGGAGCTCCGCAGCGG + Exonic
1066141085 10:32505313-32505335 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1066927246 10:41713484-41713506 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1067086759 10:43244253-43244275 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1067100470 10:43330485-43330507 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1067101422 10:43337501-43337523 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1068536454 10:58244909-58244931 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1069452069 10:68525967-68525989 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1069674515 10:70238202-70238224 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1069771565 10:70903703-70903725 GGCAGTGGGCAGCTCTGCCTAGG + Intergenic
1071149723 10:82620103-82620125 GGCCGCAGGCACCCCCACCTAGG - Intronic
1072781821 10:98256802-98256824 GCCTGCCGACAGCTCGGCCTGGG - Exonic
1072947315 10:99821484-99821506 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1072955755 10:99886459-99886481 GGCCGACTGCAGCTCCTCCAGGG + Exonic
1073298358 10:102455017-102455039 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1076668240 10:132104858-132104880 GGCCGCCTGCAGCGCCGCGAGGG - Exonic
1077040294 11:518034-518056 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1077210873 11:1370443-1370465 GGCAGTCGGGAGCTCGGCCTGGG + Intergenic
1078327426 11:10391956-10391978 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1080982976 11:37430590-37430612 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1081014498 11:37859232-37859254 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1083040554 11:59681457-59681479 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1083131159 11:60623513-60623535 GGCCGCGGGGTCCTCCGCCTAGG + Intergenic
1083285421 11:61655656-61655678 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1083372777 11:62194959-62194981 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1083467618 11:62859163-62859185 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1083543138 11:63528618-63528640 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1083562164 11:63681635-63681657 GGCCGCCGACGGCTCCGCCATGG - Exonic
1084207426 11:67604001-67604023 GGCCGCAGGGACCTCTGCCTAGG - Exonic
1084247416 11:67868611-67868633 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1084830796 11:71767592-71767614 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1084880075 11:72164672-72164694 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1085284737 11:75352207-75352229 GGCCGCAGGGAGCGCGGCCTCGG - Intergenic
1085408525 11:76278109-76278131 GGGAGACGGCAGCTCCGCCAGGG + Intergenic
1085716890 11:78880321-78880343 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1085822208 11:79804931-79804953 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1086666585 11:89491286-89491308 GGCCGCCGCCCGCTCCTTCTCGG - Exonic
1087314114 11:96586428-96586450 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1087723708 11:101695361-101695383 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1087724639 11:101703859-101703881 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1088829704 11:113524669-113524691 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1089471236 11:118721660-118721682 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1089472131 11:118729853-118729875 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1092381676 12:8001818-8001840 GGCCGTAGCCAGCTCAGCCTTGG - Intergenic
1092437511 12:8462230-8462252 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1092455077 12:8635955-8635977 GGCCGCAGGGACCTCCGCCTAGG + Intergenic
1092559811 12:9600764-9600786 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1092645933 12:10571915-10571937 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1093650928 12:21645241-21645263 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1094389379 12:29932701-29932723 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1096420710 12:51454934-51454956 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1096489713 12:52006956-52006978 AGCCGCCGCCAGCCCCGCCGAGG + Exonic
1096940030 12:55333729-55333751 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1097076819 12:56401008-56401030 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1097330540 12:58328106-58328128 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1097399134 12:59108513-59108535 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1097626983 12:62011615-62011637 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1098023209 12:66175582-66175604 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1099654344 12:85469584-85469606 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1100309135 12:93378140-93378162 GGCCGGCGGCCGCTCCGACGCGG - Exonic
1101170575 12:102088838-102088860 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1101520673 12:105479207-105479229 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1101605781 12:106247232-106247254 GGGAGCCGGCCGCTCCTCCTTGG - Intronic
1101935375 12:109052695-109052717 GGCCGCGGTCATCGCCGCCTCGG - Exonic
1102135433 12:110570336-110570358 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1102588606 12:113940647-113940669 GGCTGCCTGGAGCTCTGCCTAGG - Intronic
1103092345 12:118106275-118106297 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1103350007 12:120277617-120277639 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1103776916 12:123372705-123372727 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1104466335 12:128993868-128993890 GGCCCCCAGCAGATCCTCCTGGG + Intergenic
1104916956 12:132270629-132270651 GACGGCCGACAGCTCCACCTGGG - Intronic
1105349112 13:19600516-19600538 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1107285874 13:38791556-38791578 GGCAGAAGGCAGCTCCTCCTGGG + Intronic
1107737472 13:43415374-43415396 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1108118748 13:47160396-47160418 GGCCGAGGGCAGCTCAGCATGGG + Intergenic
1108813918 13:54267445-54267467 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1109959823 13:69615523-69615545 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1110782382 13:79481298-79481320 GGCCGCCGAGACCTCCGCGTTGG - Exonic
1113497483 13:110743375-110743397 GGCCTTGGGCAGCTCTGCCTTGG + Intergenic
1113656023 13:112068174-112068196 CGCCGCCCGCCGCGCCGCCTGGG - Exonic
1114069987 14:19098595-19098617 GGCAGGCAGCGGCTCCGCCTCGG + Intergenic
1114092275 14:19301407-19301429 GGCAGGCAGCGGCTCCGCCTCGG - Intergenic
1114154432 14:20084886-20084908 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1114491895 14:23107821-23107843 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1115898507 14:38118398-38118420 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1116502420 14:45636306-45636328 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1117365615 14:55024848-55024870 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1118184407 14:63523576-63523598 GGCCGCAGGGTCCTCCGCCTAGG + Intronic
1118238775 14:64037258-64037280 GGCCGCAGGGTCCTCCGCCTAGG - Intronic
1119029758 14:71182806-71182828 GGCCTCCTGCAGCCCCGCCGTGG - Intergenic
1119823153 14:77635924-77635946 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1119826637 14:77662045-77662067 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1119841338 14:77795321-77795343 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1121208200 14:92187174-92187196 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1121253086 14:92513911-92513933 TGCCGCCGGCAGCTCCGGGACGG - Exonic
1121681330 14:95795057-95795079 GGCTGCAGGCTGCTCCTCCTGGG + Intergenic
1122933775 14:104946646-104946668 GGGGGCCGTCACCTCCGCCTTGG + Exonic
1124132448 15:27003349-27003371 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1124347230 15:28930910-28930932 AGCAGCAGGCAGCTCCTCCTTGG + Intronic
1124571321 15:30866806-30866828 GGCCACAGGCAGGTCAGCCTTGG + Intergenic
1124971651 15:34495201-34495223 GGCCGCCTGCAGCACGACCTGGG - Intergenic
1125032352 15:35085410-35085432 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1126165457 15:45650973-45650995 ACCCGGGGGCAGCTCCGCCTCGG - Intronic
1127192115 15:56541291-56541313 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1127262761 15:57337979-57338001 GGACGCCTGCTGCTCCGCCGGGG - Intergenic
1127769498 15:62219473-62219495 GGCCGCCGGGTCCTCTGCCTAGG + Intergenic
1128131030 15:65227189-65227211 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1128193941 15:65733952-65733974 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1129184865 15:73899885-73899907 GGCCCCAGGGAGCTCAGCCTGGG + Intergenic
1129485883 15:75871501-75871523 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1129488856 15:75904079-75904101 GGCCACCCGCAGCAACGCCTTGG - Exonic
1129589239 15:76900206-76900228 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1130944491 15:88540850-88540872 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1131119780 15:89814935-89814957 GCCCGCCCGCAGCTCCGCCCGGG + Intronic
1131200068 15:90388495-90388517 GGCTGCCGGCAGCTCGGACCCGG + Intronic
1132440611 15:101860624-101860646 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1132494933 16:258281-258303 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1132549304 16:547768-547790 AGAGGCCGGCAGCTCCACCTCGG + Exonic
1132598697 16:764492-764514 GGCCGCCTGCAGCGCTGCCCTGG - Intronic
1133126634 16:3651598-3651620 GACAGCAGCCAGCTCCGCCTTGG + Intronic
1133188500 16:4116539-4116561 GGCCGCGCGCCGCCCCGCCTTGG + Intergenic
1133259221 16:4537886-4537908 GGCCGTCGCCATCTCCGCCGGGG + Intronic
1133433022 16:5755035-5755057 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1133680543 16:8115788-8115810 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1133687443 16:8179408-8179430 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1133811872 16:9166943-9166965 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1133833773 16:9349706-9349728 GGCCACAGGCACCTCTGCCTAGG - Intergenic
1135289415 16:21222433-21222455 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1136930387 16:34412704-34412726 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1136974187 16:34999104-34999126 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1137366572 16:47864757-47864779 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1137388004 16:48058664-48058686 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1139088798 16:63618634-63618656 GGGCGCCTGCAGCTGTGCCTGGG + Intergenic
1140418907 16:74800040-74800062 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1140703226 16:77601890-77601912 GGTCACCGGCACCTCTGCCTGGG + Intergenic
1141068361 16:80932124-80932146 GGGAGTCGGCAGCGCCGCCTGGG + Intergenic
1141662593 16:85449385-85449407 GGCAGCCGGCAGCTGGGCCGAGG + Intergenic
1142484458 17:237533-237555 GGACACAGGCAGCTCCGGCTGGG - Intronic
1142812450 17:2401567-2401589 AGTCGCCGGCAGCTCCGCCCAGG - Intergenic
1142979705 17:3664469-3664491 GGCCGCCTCCTGCTCCTCCTGGG + Intronic
1143195788 17:5075326-5075348 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1143561939 17:7701652-7701674 GGCTGCCGTCAGCTCATCCTGGG - Exonic
1144579136 17:16448056-16448078 GGCCTCCCCCAGCTCAGCCTGGG - Intronic
1144624044 17:16835522-16835544 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1144745520 17:17611571-17611593 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1144882382 17:18437193-18437215 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1145031061 17:19505601-19505623 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1145053947 17:19685668-19685690 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1145149852 17:20507193-20507215 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1145303654 17:21657287-21657309 GGCCGCCTGAACCTCCGCCAGGG + Intergenic
1145346390 17:22044562-22044584 GGCCGCCTGAACCTCCGCCAGGG - Intergenic
1145927368 17:28658384-28658406 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1146181445 17:30700688-30700710 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1146183058 17:30709414-30709436 GGCCGCTGCCGGCGCCGCCTCGG + Intergenic
1146839457 17:36140351-36140373 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1147597236 17:41725010-41725032 GGCAGCCCCCAGCTCCTCCTGGG + Exonic
1147838745 17:43355244-43355266 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1148273733 17:46284261-46284283 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1148432022 17:47650226-47650248 CGCCGCCGCCACCTCCGCCATGG + Exonic
1148633904 17:49132719-49132741 GGCCGCCGACTGCCCCGCCCTGG - Intronic
1149202337 17:54201872-54201894 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1149427201 17:56566561-56566583 GGCCACAGGCAGGTCAGCCTTGG - Intergenic
1149641982 17:58208792-58208814 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1149659791 17:58328213-58328235 GGCCACCGACAGCTGCGCCTGGG + Intronic
1149767385 17:59290586-59290608 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1150227322 17:63531107-63531129 GGACCCCGGCAGCTCCTCCTTGG + Intronic
1150409326 17:64930320-64930342 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1150840937 17:68604639-68604661 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1151697897 17:75727429-75727451 CGCGGCCAGCAGCTCCGCCTGGG - Exonic
1152399068 17:80053345-80053367 GGCCTCCATCAGCTGCGCCTTGG + Intronic
1152663180 17:81552368-81552390 GCGCGGCGGCGGCTCCGCCTCGG + Exonic
1152707979 17:81855113-81855135 GGCCCCAGGCAGCTCTGCCCAGG - Intronic
1152910494 17:83002673-83002695 GGCCGCCCGCGGTGCCGCCTCGG - Intronic
1153143481 18:2001461-2001483 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1153422106 18:4917927-4917949 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1154943372 18:21137158-21137180 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1155971981 18:32092003-32092025 CGCCGCCAGCAGCTCTGTCTTGG - Exonic
1157885297 18:51360641-51360663 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1158695174 18:59697300-59697322 GGCCCCTGGCAGCTCCTCCCCGG + Exonic
1159413035 18:68105890-68105912 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1159477574 18:68942916-68942938 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1159484946 18:69043499-69043521 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1160032423 18:75274006-75274028 GGCCGGCGGCGCCTCCTCCTGGG + Intronic
1160704708 19:524531-524553 GCCGGCCGGAAGCTCCGTCTTGG - Intergenic
1160987951 19:1848279-1848301 GGCCGCCGGCAGGGCCCCCCGGG + Exonic
1161064441 19:2230834-2230856 GGGCGCCGGCAGCTCTGTCTGGG - Exonic
1161201796 19:3019326-3019348 AGCCGCCGCCAGCTGAGCCTGGG + Exonic
1162063624 19:8111480-8111502 GGCAGGCCGCAGCACCGCCTGGG + Intronic
1162424661 19:10587219-10587241 GGCCGCCACCATGTCCGCCTCGG - Exonic
1162538093 19:11276250-11276272 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1162668152 19:12232470-12232492 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1162724508 19:12681800-12681822 GGCCGCCGTAAGCCCGGCCTAGG - Exonic
1162805341 19:13135401-13135423 AGCCGCCGGCAGCTCCACCACGG - Exonic
1162975737 19:14206354-14206376 GGCCGCTGCCGGCGCCGCCTCGG - Intergenic
1163159698 19:15457328-15457350 GGCTGCCGCCAGCTCCTCCTTGG + Exonic
1163437330 19:17303282-17303304 GGACGCTGGCTTCTCCGCCTGGG - Exonic
1163721387 19:18899809-18899831 GGGCGCCTGGAGCTCAGCCTGGG - Intronic
1163761170 19:19137611-19137633 GGCGTCCTGCACCTCCGCCTGGG + Intronic
1163898803 19:20082637-20082659 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1163907080 19:20156987-20157009 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1164016338 19:21259018-21259040 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1164049010 19:21568242-21568264 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1164122826 19:22283834-22283856 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1164208598 19:23078038-23078060 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1164273274 19:23692987-23693009 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1164370373 19:27638237-27638259 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1164424694 19:28130928-28130950 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1164489039 19:28689959-28689981 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1164620795 19:29695031-29695053 GGCAGCCCGCAGCTCTCCCTGGG + Intergenic
1164984340 19:32637669-32637691 GGGCGGCTGCAGCTGCGCCTGGG - Intronic
1165506467 19:36234011-36234033 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1165508103 19:36247612-36247634 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1165595080 19:37006457-37006479 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1165633454 19:37321085-37321107 GGCCGCAGGGATCTCTGCCTAGG + Intronic
1165634786 19:37331689-37331711 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1165655726 19:37530450-37530472 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1165666227 19:37630592-37630614 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1165691389 19:37866475-37866497 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1166013290 19:39959876-39959898 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1166653627 19:44594394-44594416 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1167096145 19:47375965-47375987 GGCCGCTGCCAGCTCAGCCCAGG + Exonic
1167353706 19:48991356-48991378 GGCCTCCAGCAGTTCCACCTGGG + Exonic
1167818980 19:51908837-51908859 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1167831471 19:52026508-52026530 GGCCGCGGGGACCTCTGCCTAGG + Intronic
1167833104 19:52043431-52043453 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1167867407 19:52339412-52339434 GGCCGCAGGGAACTCTGCCTAGG - Intronic
1167876938 19:52421604-52421626 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1167893178 19:52558994-52559016 GGCCGCAGGAACCTCTGCCTAGG + Intronic
1167910536 19:52698386-52698408 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1167913048 19:52719895-52719917 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1167924790 19:52812633-52812655 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1167970423 19:53186075-53186097 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1168052345 19:53838924-53838946 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1168148994 19:54435048-54435070 AGCCACCGCCAGCTCCGCCTTGG - Intronic
1168213396 19:54908115-54908137 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1168219596 19:54950929-54950951 GGCCGCAGGGACCTCTGCCTAGG - Intronic
927737082 2:25534124-25534146 GGCCGCAGGGACCTCTGCCTAGG - Intronic
927891116 2:26750160-26750182 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
927992820 2:27460277-27460299 GGCCGCAGGTACCTCTGCCTAGG + Intronic
928355885 2:30614119-30614141 GGCCGCAGGGACCTCTGCCTAGG - Intronic
928540036 2:32276229-32276251 GGCCGCAGGTACCTCTGCCTAGG - Intergenic
928990220 2:37225616-37225638 GGCCGCAGGGACCTCTGCCTAGG + Intronic
929097503 2:38278083-38278105 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
929208084 2:39321459-39321481 GGCCGCAGGGACCTCCGCCTAGG + Intronic
930872802 2:56184859-56184881 CGCCGCCTGCAGCTGCACCTCGG + Exonic
932699849 2:73985058-73985080 GGCCGCCGCCGCCGCCGCCTGGG - Intergenic
932776258 2:74529993-74530015 CGCAGCCATCAGCTCCGCCTTGG - Exonic
933684614 2:85133427-85133449 CGCCGCCGCCTGCTCCGCCGGGG - Exonic
933777377 2:85779237-85779259 AGCTGCCTGCAGCTTCGCCTGGG + Intronic
933868821 2:86548315-86548337 GGCCGCAGGAACCTCTGCCTAGG - Intronic
934894463 2:98102000-98102022 GGCCGCAGGGACCTCTGCCTAGG - Intronic
935180429 2:100685165-100685187 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
935622821 2:105144081-105144103 GGCCCCCGGCAGCTGCGGCTCGG + Intergenic
936157249 2:110056370-110056392 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
936187445 2:110315074-110315096 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
936378534 2:111963489-111963511 GGCCGCAGGGACCTCTGCCTAGG - Intronic
936486987 2:112934553-112934575 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
938270126 2:129962612-129962634 GGCCGCAGGAACCTCTGCCTAGG - Intergenic
941668149 2:168262021-168262043 GGCCGTAGCCAGCTCAGCCTTGG - Intergenic
943578229 2:189654349-189654371 GGCCGCCGGGTCCTCTGCCTAGG + Intergenic
943880909 2:193142720-193142742 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
943977703 2:194504959-194504981 GGCCGCGGGGACCTCTGCCTAGG - Intergenic
944461642 2:199955887-199955909 GGCCGACGGCAGCCTCACCTCGG - Exonic
944581969 2:201139300-201139322 GGCCGCAGGGACCTCTGCCTAGG + Intronic
944632761 2:201643422-201643444 GGCCGCCGGCGGTTGCGCCGGGG - Exonic
945175194 2:207037123-207037145 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
947520763 2:230844284-230844306 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
947613423 2:231538328-231538350 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
947619066 2:231577074-231577096 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1169125899 20:3126375-3126397 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1170315053 20:15032244-15032266 GGGCGACTGCAGCTCCACCTGGG + Intronic
1170617804 20:17968481-17968503 GGCCGCCGCCGCCGCCGCCTGGG + Intronic
1171256834 20:23695005-23695027 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1171291007 20:23982941-23982963 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1171450774 20:25234485-25234507 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1171521174 20:25774972-25774994 GGCCGCCTGAACCTCCGCCAGGG + Exonic
1171555750 20:26081506-26081528 GGCCGCCTGAACCTCCGCCAGGG - Intergenic
1172479521 20:35262771-35262793 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1173319048 20:41971194-41971216 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1174317463 20:49713761-49713783 GGCCGCCGCCGCCACCGCCTGGG + Exonic
1175415531 20:58798268-58798290 GGCAGCCGGCAGCTCCTCCATGG + Intergenic
1175465920 20:59191327-59191349 GGCCGCCGGCTTCCCCACCTGGG - Exonic
1175856278 20:62122541-62122563 GCCCGCCGCCGCCTCCGCCTGGG - Exonic
1176110464 20:63408452-63408474 GTCCTCGGGCAGCTCCGCCTCGG + Exonic
1176178447 20:63739228-63739250 GGCCGGCAGGAGCACCGCCTCGG - Intronic
1176424454 21:6539462-6539484 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1177005940 21:15672321-15672343 GGCCGCAGGTACCTCTGCCTAGG - Intergenic
1177175172 21:17694863-17694885 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1177199096 21:17933367-17933389 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1177249131 21:18569324-18569346 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1178124259 21:29499997-29500019 GGCCGCAGGCAGGGCAGCCTGGG + Intronic
1179444470 21:41421516-41421538 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1179699947 21:43147777-43147799 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1180159616 21:45993212-45993234 GGCCGCCGGCATCTCGGCTCTGG - Intronic
1180159796 21:45993934-45993956 GGAGGCCGGCAGCTCCTCCTGGG - Intronic
1180333000 22:11549962-11549984 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1180488455 22:15821159-15821181 GGCAGGCAGCGGCTCCGCCTCGG + Intergenic
1180766409 22:18348146-18348168 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1180779906 22:18514232-18514254 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1180812620 22:18771553-18771575 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1180837715 22:18938972-18938994 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1180838624 22:18947183-18947205 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1181198779 22:21205801-21205823 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1181400958 22:22649998-22650020 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1181534865 22:23536360-23536382 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1181642629 22:24211536-24211558 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1181702936 22:24631090-24631112 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1181983303 22:26781800-26781822 GGCTGCCGGCATCTCTGCCCAGG + Intergenic
1182319673 22:29470439-29470461 CGCCGCCTTCAGCCCCGCCTTGG - Intergenic
1183466705 22:37983794-37983816 GGCCGCCGCCGCCGCCGCCTCGG + Exonic
1184480008 22:44740869-44740891 GGCTGCAGGCATCTCCACCTTGG - Intronic
1185315144 22:50175745-50175767 GGCAGCCGGGAGCTCCGTGTGGG + Intronic
1203228026 22_KI270731v1_random:89036-89058 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1203287806 22_KI270734v1_random:164271-164293 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
950387901 3:12674414-12674436 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
950442742 3:13019468-13019490 GGCCGCCGGCAGCTCCGCCTTGG + Intronic
950481183 3:13245162-13245184 GGCTGCCGGCAGCTCAGCAAGGG + Intergenic
950607132 3:14091832-14091854 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
950629527 3:14273142-14273164 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
951881288 3:27483832-27483854 CGCCGCCGGCCGCCCCGACTCGG + Intronic
951927212 3:27921610-27921632 GGCTGCTGGCAGCTCTGCATGGG + Intergenic
953652501 3:44820477-44820499 GGCCGCAGGGTCCTCCGCCTAGG - Intronic
953960068 3:47259832-47259854 GGCCGCAGGGACCTCTGCCTAGG + Intronic
954440651 3:50520180-50520202 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
954876012 3:53803645-53803667 GGCCACCGGCAGCTGCACTTGGG + Intronic
956677997 3:71753588-71753610 CGCCGCCGCCAGCCCCGCCGAGG - Intronic
958431576 3:94045311-94045333 GGCTGCAGGGAGCTCTGCCTAGG + Intronic
958560660 3:95744289-95744311 GGCCGCCGGGTCCTCTGCCTAGG - Intergenic
958943274 3:100336973-100336995 GGCCGCAGGGACCTCTGCCTAGG - Intronic
959070761 3:101700346-101700368 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
959071319 3:101704480-101704502 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
960027451 3:113024924-113024946 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
960028364 3:113033123-113033145 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
960918741 3:122724777-122724799 GGCCGCAGGGATCTCTGCCTAGG - Intronic
961182251 3:124886608-124886630 GACCGCCGCCAGCCCTGCCTTGG - Intronic
961296729 3:125890749-125890771 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
961297549 3:125899083-125899105 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
961512612 3:127412309-127412331 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
966073375 3:175906197-175906219 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
967025883 3:185563195-185563217 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
967026792 3:185571407-185571429 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
967179717 3:186893518-186893540 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
967284757 3:187858270-187858292 GGCCCCTGGAAGCTCCGCCGGGG - Intergenic
967418923 3:189252018-189252040 GGCCGCAGGGACCTCTGCCTAGG - Intronic
968095630 3:195928172-195928194 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
968185820 3:196632992-196633014 ACCCTCCGGCAGCTCCTCCTTGG - Intergenic
968387260 4:152389-152411 GGCCGCAGGGACCTCTGCCTAGG - Intronic
968441389 4:626267-626289 GGCCGCCTGCCTCTCCGACTCGG + Intronic
968963831 4:3759417-3759439 GCCCGCTGGCAGCCCTGCCTCGG - Intergenic
972586208 4:40438830-40438852 GGCCGCCGGGTCCTCCGCCAAGG - Exonic
972624878 4:40787189-40787211 GGCCGCAGGGACCTCTGCCTAGG + Intronic
973317817 4:48779984-48780006 CGCCGCCGGCAGCCCAGCCTGGG - Intronic
974517941 4:62941176-62941198 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
974661891 4:64900689-64900711 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
974848933 4:67382233-67382255 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
974924658 4:68282105-68282127 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
975246854 4:72129871-72129893 GGCCGCAGGGACCTCTGCCTAGG - Intronic
978519877 4:109604252-109604274 GGCCGCAGGGACCTCTGCCTAGG + Intronic
978527039 4:109677944-109677966 GGCCGCAGGGACCTCTGCCTAGG - Intronic
978822318 4:112980077-112980099 GGCTGAGGGCAGCTCTGCCTGGG - Intronic
979141636 4:117183411-117183433 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
979235909 4:118399965-118399987 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
979327456 4:119396663-119396685 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
979547244 4:121951865-121951887 GGGCGGCGGCAGCTCGGCTTCGG - Intergenic
981494418 4:145375541-145375563 GGCCGCCGATGGCTCCGCCATGG - Intergenic
981617358 4:146655455-146655477 CTCCGCCGGCCGCTCCGCCGCGG + Intergenic
982512868 4:156305409-156305431 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
982711205 4:158760179-158760201 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
982876576 4:160659084-160659106 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
983205475 4:164906161-164906183 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
983214483 4:164990681-164990703 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
983215160 4:164995985-164996007 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
983215878 4:165002248-165002270 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
984060498 4:174984001-174984023 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
985738100 5:1596624-1596646 GGCCACAGGCACCTCTGCCTAGG - Intergenic
986130469 5:4925227-4925249 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
986549605 5:8938039-8938061 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
987490837 5:18578753-18578775 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
987658471 5:20839739-20839761 GGCCTTAGGCAGCTCTGCCTCGG - Intergenic
988380924 5:30495786-30495808 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
988547792 5:32174285-32174307 CGCCGCCGCCGCCTCCGCCTTGG - Exonic
988765214 5:34366205-34366227 GGCCTTAGGCAGCTCTGCCTCGG + Intergenic
988850584 5:35176684-35176706 GGCCGCAGGGACCTCTGCCTAGG + Intronic
989737937 5:44731134-44731156 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
989991603 5:50773965-50773987 GGCCGCAGGGACCTCTGCCTAGG - Intronic
990297676 5:54420167-54420189 GGCCGCAGGGACCTCGGCCTAGG - Intergenic
990616897 5:57518029-57518051 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
990708989 5:58562621-58562643 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
990870886 5:60430669-60430691 GGCCGCAGGGACCTCTGCCTAGG - Intronic
991221848 5:64226529-64226551 GGCCGCAGGGACCTCTGCCTAGG + Intronic
991690557 5:69221050-69221072 GGCCGCAGGGACCTCTGCCTAGG + Intronic
992320226 5:75606480-75606502 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
992320671 5:75610963-75610985 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
993092065 5:83438333-83438355 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
994532014 5:100983681-100983703 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
995878835 5:116821429-116821451 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
996163433 5:120195331-120195353 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
997890492 5:137672176-137672198 GGCTGCCAACAGCTCGGCCTAGG + Intronic
997892563 5:137688033-137688055 GGCCGCAGGGACCTCTGCCTAGG + Intronic
998366657 5:141636837-141636859 GGCCGCCGCCAGCCCCTCCCCGG + Exonic
998419249 5:141968973-141968995 TCGCGCCGGCAGCGCCGCCTTGG + Intronic
999768436 5:154757022-154757044 GCCCGCGGGCCGCTCGGCCTCGG + Intronic
999951726 5:156658353-156658375 GGCCGCAGGGACCTCTGCCTAGG - Intronic
999952629 5:156666565-156666587 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1001232126 5:169997522-169997544 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1001292456 5:170473608-170473630 GGCCCCTGGCAGCTCAGCATGGG + Intronic
1002377445 5:178798375-178798397 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1002920047 6:1561660-1561682 AGCTGCTGGCAGCTCCGCCTGGG - Intergenic
1003066572 6:2908962-2908984 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1004427023 6:15513559-15513581 GGCGGCCAGAAGCTCCGCCGAGG - Intronic
1005177217 6:23060372-23060394 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1005534837 6:26744972-26744994 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1005638766 6:27775107-27775129 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1006054255 6:31369420-31369442 GGCAGCTGCCAGCTCAGCCTTGG - Intergenic
1006399799 6:33810607-33810629 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1006538478 6:34720107-34720129 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1007544875 6:42686206-42686228 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1007792276 6:44317306-44317328 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1007793549 6:44328689-44328711 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1008565282 6:52762128-52762150 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1008582966 6:52922970-52922992 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1008909752 6:56720481-56720503 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1008965321 6:57309064-57309086 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1009336078 6:62492424-62492446 GGCCACCCGCAGCTCCGCAAAGG + Intergenic
1009393009 6:63165073-63165095 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1009844664 6:69121133-69121155 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1009868828 6:69431916-69431938 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1010591479 6:77717592-77717614 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1010592416 6:77726054-77726076 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1010686395 6:78859086-78859108 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1011536534 6:88381886-88381908 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1011610548 6:89146410-89146432 GGCCTCCGGCGGCTCCCACTCGG - Exonic
1011967152 6:93173663-93173685 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1012458121 6:99429669-99429691 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1013555804 6:111255735-111255757 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1013638156 6:112048223-112048245 GGCCGCAGGGTGCTCTGCCTAGG + Intergenic
1013792630 6:113854849-113854871 GGCCGCCGGCAGCGCCCCCAAGG + Intergenic
1013921836 6:115415174-115415196 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1014363274 6:120507460-120507482 GGCCGCAGCCAGGTCAGCCTTGG + Intergenic
1014800851 6:125776496-125776518 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1015285204 6:131478956-131478978 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1015574802 6:134659757-134659779 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1017171133 6:151455857-151455879 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1017719706 6:157236079-157236101 GGCCGCGCTCGGCTCCGCCTGGG + Intergenic
1017785417 6:157752860-157752882 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1017855552 6:158348303-158348325 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1018024694 6:159795378-159795400 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1019163711 6:170085640-170085662 GCACTCGGGCAGCTCCGCCTTGG - Intergenic
1019386140 7:757250-757272 GGCCGCCTGCAGCTGGGGCTGGG - Intronic
1019651693 7:2162455-2162477 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1019687556 7:2390052-2390074 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1019714750 7:2533619-2533641 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1019976153 7:4583073-4583095 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1019977087 7:4591577-4591599 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1019978023 7:4600080-4600102 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1020034964 7:4959165-4959187 GGGCGCCTCCAGCTCCGGCTCGG - Exonic
1020137106 7:5593718-5593740 GGCCGCCTGCAGCACGACCTGGG - Exonic
1021067763 7:16198020-16198042 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1021671571 7:23040154-23040176 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1021747570 7:23757858-23757880 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1022100440 7:27166232-27166254 GGCCGGCGGCGGCTCCGTTTGGG - Intronic
1022542832 7:31154099-31154121 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1022757226 7:33305001-33305023 GGCCGCAGGGAACTCTGCCTAGG + Intronic
1023913118 7:44569267-44569289 GGCCTCCTGCACCTCCCCCTTGG + Intronic
1023953879 7:44870455-44870477 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1025850994 7:65243680-65243702 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1025853670 7:65260802-65260824 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1026008674 7:66619605-66619627 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1027059393 7:75073594-75073616 GACCACGGGCACCTCCGCCTCGG + Exonic
1029055256 7:97733718-97733740 GGGCTCCGGCAGTTCCTCCTGGG - Exonic
1029534785 7:101150500-101150522 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1029966701 7:104748220-104748242 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1030760322 7:113342164-113342186 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1031606966 7:123780935-123780957 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1031724616 7:125221817-125221839 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1031795406 7:126168458-126168480 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1032129596 7:129217129-129217151 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1032179430 7:129662883-129662905 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1033159062 7:138981175-138981197 GGCCGTCGGCCGCTCGGCCCCGG + Exonic
1033185961 7:139226830-139226852 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1033349894 7:140553624-140553646 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1034034010 7:147801450-147801472 GGCCGCAGGGTGCTCTGCCTAGG - Intronic
1034781646 7:153887237-153887259 GGACGCCGGCGGCTCGGCCCCGG - Intronic
1035111124 7:156482893-156482915 GGCTGCCGTCAGCACCGCCCCGG + Intergenic
1035349640 7:158237089-158237111 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1036291701 8:7498522-7498544 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1036292632 8:7507025-7507047 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1036786644 8:11692558-11692580 GGGCCGCGGCGGCTCCGCCTGGG + Intronic
1037429429 8:18794247-18794269 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1037820654 8:22133282-22133304 GGCCGGGGGCTGCTCCGCCCGGG - Intronic
1037913429 8:22757862-22757884 GGCCACCTGCAGCCCTGCCTGGG + Intronic
1039392665 8:37194015-37194037 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1039674883 8:39651442-39651464 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1040027638 8:42796341-42796363 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1040124721 8:43724527-43724549 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1040126178 8:43740186-43740208 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1040409353 8:47138541-47138563 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1040413320 8:47176680-47176702 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1041060765 8:54032328-54032350 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1041374557 8:57200251-57200273 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1041513078 8:58672388-58672410 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1041654518 8:60335739-60335761 GGCCTTGGGCAGCTCCGCCTTGG - Intergenic
1042535741 8:69856408-69856430 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1043278978 8:78439072-78439094 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1044310154 8:90684330-90684352 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1044310286 8:90685177-90685199 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1044581793 8:93832826-93832848 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1044857784 8:96494063-96494085 CGCCGCCCGCAGCTGCGCCCCGG - Exonic
1046334865 8:112772473-112772495 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1048947229 8:139460553-139460575 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1049222769 8:141435428-141435450 GGCCGCGGGCAGACCAGCCTGGG - Intergenic
1049554704 8:143276035-143276057 GCCCGCCGGCCGCTCCGCGCTGG - Exonic
1049557037 8:143287931-143287953 GGCCGCCGGGTCCTCTGCCTAGG - Intergenic
1049663613 8:143832287-143832309 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1049667134 8:143850350-143850372 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1049686300 8:143940558-143940580 GGCCAGAGGCAGCTCCGCCCCGG - Intronic
1049845002 8:144796192-144796214 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1049867859 8:144950605-144950627 GGGCGGGGGCAGCTCGGCCTGGG - Intronic
1050418082 9:5435185-5435207 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1052279404 9:26715858-26715880 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1052676600 9:31633526-31633548 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1052928853 9:34039711-34039733 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1054322257 9:63682256-63682278 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1055157968 9:73087854-73087876 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1056228948 9:84525888-84525910 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1057489177 9:95508480-95508502 GGCCGCAGGCTGCTCGGGCTCGG + Exonic
1057626993 9:96686747-96686769 CGCCCCCTGCAGCTCGGCCTGGG - Intergenic
1057674696 9:97129865-97129887 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1057838390 9:98464985-98465007 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1058368095 9:104234360-104234382 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1058806235 9:108594903-108594925 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1058885718 9:109320302-109320324 GGCCGCCGCCGCCTCCTCCTCGG - Exonic
1060167343 9:121429404-121429426 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1060590124 9:124811223-124811245 GGCAGCCGGCAGCTCTGCCAGGG + Exonic
1060974191 9:127755015-127755037 GACCCCCGGCCGCTCCGCCCGGG - Intronic
1061290521 9:129648384-129648406 GGCAGCCGACAGCCCCTCCTGGG - Intergenic
1061437999 9:130579047-130579069 GGCCACCGCCACTTCCGCCTGGG - Intronic
1061554232 9:131357009-131357031 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1061574701 9:131498767-131498789 TGACGCTGGCAGCTCTGCCTTGG + Exonic
1061788478 9:133045324-133045346 TCCCGCCGGCAGCACCGCCCTGG + Intronic
1061829703 9:133283702-133283724 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1061955258 9:133958071-133958093 GGCCGCAGGGACCTCTGCCTAGG + Intronic
1061979529 9:134093083-134093105 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1062098540 9:134715571-134715593 GGCCGCGGGGACCTCTGCCTAGG - Intronic
1203456755 Un_GL000219v1:175509-175531 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1185877659 X:3713463-3713485 GGCCGGCGGCTGCTCCCACTCGG - Exonic
1187198881 X:17115657-17115679 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1187215750 X:17275033-17275055 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1187385792 X:18847136-18847158 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1187464410 X:19515027-19515049 GGCCGCCGGCCGCGCCGCCCTGG + Exonic
1187844756 X:23523977-23523999 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1191033348 X:55998417-55998439 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1191161639 X:57335802-57335824 GGCCGCAGGTACCTCTGCCTAGG - Intronic
1192481770 X:71492293-71492315 GGACGCCTGCCGCTACGCCTTGG + Intronic
1192626418 X:72733483-72733505 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1192885538 X:75334055-75334077 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1193047275 X:77066535-77066557 GGCCGCAGGGACCTCTGCCTGGG + Intergenic
1194200745 X:90950914-90950936 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1194611373 X:96050415-96050437 GGCCGCAGGGTCCTCCGCCTAGG - Intergenic
1195153089 X:102094225-102094247 GGCCACAGGCAGGTCAGCCTTGG + Intergenic
1197101096 X:122655938-122655960 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1197383832 X:125779809-125779831 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1198297709 X:135303384-135303406 GGCCGCAGGGACCTCTGCCTAGG - Intronic
1198308554 X:135406397-135406419 GGCCGCAGGGACCTCTGCCTAGG + Intergenic
1198602277 X:138296429-138296451 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1198696340 X:139342567-139342589 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1199256236 X:145721488-145721510 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1200086508 X:153609882-153609904 GGCCGCCGCGAGCCCCTCCTGGG + Intergenic
1201295974 Y:12463523-12463545 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1201356726 Y:13104469-13104491 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1202029096 Y:20553122-20553144 GGCCGCAGGAACCTCTGCCTAGG + Intergenic
1202253173 Y:22893686-22893708 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1202406163 Y:24527435-24527457 GGCCGCAGGGACCTCTGCCTAGG - Intergenic
1202464619 Y:25142646-25142668 GGCCGCAGGGACCTCTGCCTAGG + Intergenic