ID: 950443228

View in Genome Browser
Species Human (GRCh38)
Location 3:13021981-13022003
Sequence CTGGCTGTCGACTGTTGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950443228_950443233 3 Left 950443228 3:13021981-13022003 CCGGCCCAACAGTCGACAGCCAG 0: 1
1: 0
2: 2
3: 3
4: 100
Right 950443233 3:13022007-13022029 GAGCAGCCATGCACGCGTCCCGG 0: 1
1: 0
2: 0
3: 8
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950443228 Original CRISPR CTGGCTGTCGACTGTTGGGC CGG (reversed) Intronic
902612315 1:17604403-17604425 CTGGCTGTGTACTCTGGGGCTGG - Intronic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
905261312 1:36721309-36721331 CTGTCTGTCCCCTGTGGGGCAGG - Intergenic
906294389 1:44640389-44640411 CTCTCTGTCGCCTGTTGGGAGGG + Intronic
906668976 1:47641201-47641223 CTGGCTTTGGACTGCTGGGGGGG + Intergenic
907421187 1:54348465-54348487 CTGGGTGTCACCTGTTTGGCAGG - Intronic
908492745 1:64663044-64663066 CTGGCTGTGTGATGTTGGGCAGG - Intronic
909514193 1:76488877-76488899 CTGGCTGTTGACTGTCCAGCAGG + Intronic
910559623 1:88576597-88576619 GTGGCTGTCTTCTGTTGGCCAGG + Intergenic
911089634 1:94008259-94008281 CAGCCTGTCCACTGCTGGGCTGG + Exonic
912405787 1:109436531-109436553 CTGGCTGAGGACTTGTGGGCAGG - Intergenic
916114106 1:161472874-161472896 CTGGCTGCCGACTGCTGGGTTGG - Intergenic
918315909 1:183322585-183322607 CAGTCTGTAGACTGTTGGTCTGG - Intronic
921218230 1:212954810-212954832 CTGACTGTCCACATTTGGGCTGG - Intronic
922712706 1:227845388-227845410 CTTGGTGTCCACTGTGGGGCAGG + Intronic
1066354398 10:34667707-34667729 CTGGCTGTCAATTTTGGGGCTGG - Intronic
1068526220 10:58133443-58133465 CTGGCTTTCGCCTATTGGCCAGG - Intergenic
1072756862 10:98027233-98027255 CTGGCTGTCGACATCTGAGCTGG - Intronic
1081484943 11:43520313-43520335 CTGGGTGTGGACTGTGTGGCTGG + Intergenic
1085270459 11:75267018-75267040 CTGGCTGAACCCTGTTGGGCAGG - Intronic
1087010631 11:93510736-93510758 CTGGCTTACATCTGTTGGGCAGG - Intronic
1099364991 12:81758199-81758221 TTGGCTGTGTCCTGTTGGGCAGG - Intronic
1100594659 12:96061470-96061492 CTGTCTGTAGGCTCTTGGGCAGG + Intergenic
1104789787 12:131474232-131474254 CTGGCTGTGCCCTGGTGGGCGGG - Intergenic
1117973995 14:61280451-61280473 CTGGCCGGCGCCAGTTGGGCGGG + Exonic
1119704179 14:76773771-76773793 CCCGCTGTTGACTGTGGGGCTGG - Intronic
1123671702 15:22665043-22665065 CTGGCTGACGGCTGATGGGGAGG + Intergenic
1124323742 15:28738268-28738290 CTGGCTGACGGCTGATGGGGAGG + Intronic
1124527634 15:30471509-30471531 CTGGCTGACGGCTGATGGGGAGG + Intergenic
1124771025 15:32536193-32536215 CTGGCTGACGGCTGATGGGGAGG - Intergenic
1128978728 15:72171065-72171087 CTGGCTGTTCACTGTAGGACCGG - Intronic
1129208877 15:74054076-74054098 ATGGCTGTCGAGGGTTGGGGTGG + Intergenic
1132664903 16:1077121-1077143 CTGGCTGGGGGCTGTGGGGCTGG - Intergenic
1132792370 16:1698892-1698914 ATGGCTGTCGACTGTGGGCATGG - Exonic
1133788260 16:8989524-8989546 CTGGCTGTCGCTTGTTGGGCGGG + Intergenic
1134102389 16:11461256-11461278 CTGTCTGTGGCCTGTTGTGCAGG - Intronic
1134215791 16:12316184-12316206 CTGGCTGTAGCCAGTGGGGCGGG + Intronic
1142345426 16:89550788-89550810 GTGGGTGGCGACTGATGGGCGGG + Intronic
1143378138 17:6479336-6479358 CTGGCTGGACACTGTGGGGCAGG - Intronic
1152199238 17:78935492-78935514 CTGGCTGTTGCCTGGTGAGCAGG - Intergenic
1154425952 18:14272231-14272253 CTGGCAGTAGAATGGTGGGCAGG + Intergenic
1154433641 18:14327471-14327493 CTGGCAGTAGAATGGTGGGCAGG + Intergenic
1157623453 18:49029339-49029361 CAGGATGCCGAGTGTTGGGCAGG + Intergenic
1158082923 18:53615615-53615637 CAGGCTCTCAACTCTTGGGCAGG + Intergenic
1159480540 18:68985749-68985771 CTGGCAGAAGACTGGTGGGCAGG - Intronic
1162805944 19:13138135-13138157 CTGGCAGTAGTCTGTGGGGCAGG - Exonic
1164616767 19:29671782-29671804 CTGGCTTTCTACTGGTGGCCAGG + Intronic
1166619278 19:44281145-44281167 ATGGGTGTCGGGTGTTGGGCTGG + Intronic
1167348728 19:48962441-48962463 CTGGCTGGCGACTGAGAGGCTGG + Intergenic
927257072 2:21048918-21048940 CTGGCTCTGGAATGGTGGGCAGG + Intergenic
929802977 2:45120228-45120250 CTGGATGTTGAATGGTGGGCAGG + Intergenic
932634876 2:73379321-73379343 GAGGCTGTCCACTGCTGGGCGGG - Intergenic
934992531 2:98931609-98931631 CTGGCTGTGGTGTGTGGGGCTGG - Intronic
940255188 2:151721026-151721048 CTGACTGTAGACTGGTGGTCTGG - Intronic
941001290 2:160205826-160205848 ATGGCTGTCTGCTCTTGGGCGGG + Intronic
942806851 2:179940924-179940946 CTGGCTGTTGACATTTAGGCAGG - Intergenic
944470213 2:200045236-200045258 CTGTCTGGGGACTGTTGGGAAGG - Intergenic
946749538 2:222879805-222879827 CTGGCCTACGACTGTTGGGAAGG - Intronic
948591449 2:239053343-239053365 CTGTCTCTAGTCTGTTGGGCAGG + Intronic
1172391306 20:34567209-34567231 CTGGCGGCCGACTGTGGAGCTGG + Intronic
1173121148 20:40290472-40290494 CAGGCTGTCAACTTTTGGGGAGG - Intergenic
1176157193 20:63627679-63627701 GTGGGTGCCGGCTGTTGGGCAGG - Intergenic
1180998865 22:19978622-19978644 CTGGCTGTCAAGTGATGGGAAGG + Intronic
1184491289 22:44810658-44810680 CTGCCTGTGGAGTGGTGGGCAGG + Intronic
1185216973 22:49606785-49606807 CTGGCTGGCGGCTGCTGGGGTGG - Intronic
950443228 3:13021981-13022003 CTGGCTGTCGACTGTTGGGCCGG - Intronic
950450075 3:13060499-13060521 CTGGCTTTCCACCGATGGGCGGG + Intronic
951035795 3:17930601-17930623 CTGGCTGCTGACTGTTGGGTGGG + Intronic
951357584 3:21687149-21687171 CTGGCTGTTGACTGTGGATCTGG - Intronic
953900054 3:46834827-46834849 ATGGCTGTCCACTTTTGGACAGG - Intergenic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
960869276 3:122232653-122232675 CTGGCTGTGGGCTGTTGGCAAGG + Intronic
961793566 3:129393737-129393759 CTGGCTGCTGAGTCTTGGGCTGG + Intergenic
964326685 3:155554181-155554203 TTGGCAGTTGACTGTTGGGATGG - Exonic
966557997 3:181285313-181285335 CTGGCATTCTCCTGTTGGGCAGG + Intergenic
967933917 3:194711154-194711176 AGGGCTGTCTCCTGTTGGGCAGG + Intergenic
969228176 4:5812484-5812506 CTGGCTGTGGTGTGTGGGGCTGG - Exonic
969458620 4:7315451-7315473 CTGGCTGTCTGCTCTGGGGCAGG + Intronic
984536438 4:180981668-180981690 TTGCCTGTCCACAGTTGGGCAGG - Intergenic
987309686 5:16670496-16670518 CTGGCTGCCGTGTGTTGGGGTGG - Intronic
987729780 5:21754086-21754108 CTGCCTGTCCAATGTTGGACTGG - Intronic
991291323 5:65035899-65035921 CTGGCTGTCGCCTGTGGGCGGGG - Intergenic
992494869 5:77282270-77282292 CTGGCTGTCCACTCTTGGGAAGG - Intronic
998250356 5:140548237-140548259 CTGGCTGGCGTCTGTTTGGTTGG + Intronic
998588417 5:143452371-143452393 CTGGCTATGGACTTGTGGGCAGG + Intergenic
1000290256 5:159863498-159863520 CTGGCTGTGTGCTTTTGGGCAGG - Intergenic
1000780458 5:165473949-165473971 GTGGGTGTTGAATGTTGGGCAGG - Intergenic
1002581198 5:180210239-180210261 CTGGCTGGCGAGGGGTGGGCGGG + Intergenic
1004014642 6:11720827-11720849 ATGGCTGTAGAGTATTGGGCAGG - Intronic
1007748653 6:44058622-44058644 CTGGCTGTCGACAGTGGGGCAGG - Intergenic
1016979090 6:149837828-149837850 CTGGCTGTCGATTGCTCTGCAGG + Intronic
1019518315 7:1449224-1449246 CTGGCCGGCGGCTGCTGGGCTGG - Intronic
1019533048 7:1513192-1513214 CTGGCTGTGCGGTGTTGGGCAGG + Intergenic
1023820035 7:43975486-43975508 CTGGCGGGGGACTGCTGGGCTGG - Intergenic
1024971440 7:55075095-55075117 CTGGCTGCCCACTGATGGTCTGG - Intronic
1029748314 7:102528939-102528961 CTGGCGGGGGACTGCTGGGCTGG - Intergenic
1029766261 7:102628026-102628048 CTGGCGGGGGACTGCTGGGCTGG - Intronic
1032702947 7:134397952-134397974 CTGGCTGATGACTCTGGGGCTGG + Intergenic
1034699560 7:153084276-153084298 CTGGCTGTGGAGTGGTGGGGGGG - Intergenic
1048800665 8:138191228-138191250 CTGGCTGTCCAGCATTGGGCAGG - Intronic
1049775624 8:144402821-144402843 CTGTCTGTGGGCTGTTGGGGTGG - Intronic
1050136722 9:2473269-2473291 CTGGCAGTTGAAAGTTGGGCAGG + Intergenic
1053307650 9:36995516-36995538 CTGGCTGTCAACAGTGGGGATGG + Intronic
1056602018 9:88053921-88053943 CTTGCTGCAGACTGTGGGGCAGG - Intergenic
1060793388 9:126500088-126500110 CTGGCTGTGGACACTCGGGCTGG + Intronic
1196194375 X:112824588-112824610 CTGGCTTCCAACTGTTGCGCTGG + Intronic