ID: 950443228

View in Genome Browser
Species Human (GRCh38)
Location 3:13021981-13022003
Sequence CTGGCTGTCGACTGTTGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950443228_950443233 3 Left 950443228 3:13021981-13022003 CCGGCCCAACAGTCGACAGCCAG 0: 1
1: 0
2: 2
3: 3
4: 100
Right 950443233 3:13022007-13022029 GAGCAGCCATGCACGCGTCCCGG 0: 1
1: 0
2: 0
3: 8
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950443228 Original CRISPR CTGGCTGTCGACTGTTGGGC CGG (reversed) Intronic