ID: 950444618

View in Genome Browser
Species Human (GRCh38)
Location 3:13029345-13029367
Sequence ATTAACCCTGGGCGTGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950444618_950444621 -8 Left 950444618 3:13029345-13029367 CCACAGACACGCCCAGGGTTAAT 0: 1
1: 0
2: 0
3: 21
4: 121
Right 950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG 0: 1
1: 0
2: 2
3: 10
4: 130
950444618_950444622 -4 Left 950444618 3:13029345-13029367 CCACAGACACGCCCAGGGTTAAT 0: 1
1: 0
2: 0
3: 21
4: 121
Right 950444622 3:13029364-13029386 TAATACAGATAGAACATGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 179
950444618_950444624 0 Left 950444618 3:13029345-13029367 CCACAGACACGCCCAGGGTTAAT 0: 1
1: 0
2: 0
3: 21
4: 121
Right 950444624 3:13029368-13029390 ACAGATAGAACATGGCAGGGTGG 0: 1
1: 0
2: 1
3: 22
4: 287
950444618_950444626 2 Left 950444618 3:13029345-13029367 CCACAGACACGCCCAGGGTTAAT 0: 1
1: 0
2: 0
3: 21
4: 121
Right 950444626 3:13029370-13029392 AGATAGAACATGGCAGGGTGGGG 0: 1
1: 0
2: 4
3: 54
4: 629
950444618_950444625 1 Left 950444618 3:13029345-13029367 CCACAGACACGCCCAGGGTTAAT 0: 1
1: 0
2: 0
3: 21
4: 121
Right 950444625 3:13029369-13029391 CAGATAGAACATGGCAGGGTGGG 0: 1
1: 0
2: 1
3: 25
4: 291
950444618_950444623 -3 Left 950444618 3:13029345-13029367 CCACAGACACGCCCAGGGTTAAT 0: 1
1: 0
2: 0
3: 21
4: 121
Right 950444623 3:13029365-13029387 AATACAGATAGAACATGGCAGGG 0: 1
1: 0
2: 2
3: 24
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950444618 Original CRISPR ATTAACCCTGGGCGTGTCTG TGG (reversed) Intronic
905626397 1:39492568-39492590 CTTACTCCTGGGTGTGTCTGGGG - Intronic
907870119 1:58435508-58435530 ATCATCCTTGGGGGTGTCTGTGG - Intronic
909571634 1:77118855-77118877 ATTGTTCCTGGGTGTGTCTGTGG + Intronic
910167264 1:84340827-84340849 ATTATTTCTGGGGGTGTCTGTGG + Intronic
917485110 1:175448572-175448594 ATTAACCTTGGCCTAGTCTGAGG - Intronic
917639098 1:176964998-176965020 ATTGTCCCTGGGCATGACTGGGG + Intronic
919000439 1:191825427-191825449 ATTAATCCTGAGTGTATCTGAGG - Intergenic
920121457 1:203661778-203661800 CCCAGCCCTGGGCGTGTCTGTGG + Intronic
922885244 1:229015145-229015167 ATTGATCCTGGGTGCGTCTGTGG + Intergenic
923185583 1:231569779-231569801 ATTGATCTTGGGTGTGTCTGTGG - Intronic
1063149224 10:3321650-3321672 ATTGATTCTGGGTGTGTCTGTGG + Intergenic
1063422812 10:5927047-5927069 ATTAGCCATGGGCTTGTTTGTGG + Intronic
1067553318 10:47250133-47250155 ATTCACCCTGGGTGTGCCAGTGG - Intergenic
1068195838 10:53715087-53715109 ATTATTTCTGGGCATGTCTGTGG + Intergenic
1073149277 10:101300783-101300805 ATTATTTCTGGGTGTGTCTGTGG + Intergenic
1076523050 10:131093110-131093132 GTTGACCCTGGGCGTGCCGGGGG - Exonic
1077710029 11:4526940-4526962 ATTGTTCCTGGGTGTGTCTGAGG + Intergenic
1077847457 11:6040850-6040872 CTTAACCCTGGGACTGTGTGGGG + Intergenic
1083628859 11:64085684-64085706 GTTGCCCCTGGGCCTGTCTGTGG - Intronic
1083910725 11:65707867-65707889 ATTATTCCTGGGTGTGTCTTTGG - Intergenic
1085425860 11:76404021-76404043 ATTATTTCTGGGTGTGTCTGTGG - Exonic
1088970867 11:114773642-114773664 ATTATTTCTGGGTGTGTCTGTGG + Intergenic
1090321714 11:125850481-125850503 ATTGATCCTGGTTGTGTCTGAGG - Intergenic
1093663560 12:21785441-21785463 ATTATTCCTGGGTATGTCTGAGG - Intergenic
1094192777 12:27713722-27713744 ATTATTTCTGGGCATGTCTGTGG - Intronic
1098000429 12:65936477-65936499 CTTAAGCCTGGCCGTTTCTGTGG - Intronic
1098716465 12:73833117-73833139 ATTGATCCTGGGTGTGTCTGTGG - Intergenic
1100756000 12:97751497-97751519 ATTTTTCCTGGGTGTGTCTGTGG + Intergenic
1103292765 12:119860622-119860644 AATAACTCTGGGCCTGTCAGTGG + Intronic
1107587136 13:41863028-41863050 ATTGATCCTGGGTGTGTCTGTGG + Intronic
1108446158 13:50510957-50510979 ATTGTTCCTGGGTGTGTCTGTGG + Intronic
1114655849 14:24315186-24315208 GTTGACCCTGGGCATCTCTGGGG + Intronic
1120111287 14:80560563-80560585 GTTGATCCTGGGTGTGTCTGTGG + Intronic
1120350500 14:83352019-83352041 ATTAATCCTGGGTGTCTCTGTGG + Intergenic
1120834485 14:89027539-89027561 ATGAGCCCCGGGCGTGGCTGGGG - Intergenic
1122328366 14:100896515-100896537 AGTAACCCTGTGCCTGTTTGAGG + Intergenic
1122655178 14:103253983-103254005 GTTACCCCTGGGCATGGCTGCGG + Intergenic
1124650635 15:31471210-31471232 ATTATCTCTGGGTGTGTGTGAGG - Intergenic
1129699392 15:77758920-77758942 CTTCAGCCTGGGCCTGTCTGAGG + Intronic
1133573195 16:7062412-7062434 ATTTACCCTGTGCTTGTATGTGG + Intronic
1133587223 16:7207734-7207756 ATTAACCCTGGCTGTGTTGGAGG - Intronic
1137909223 16:52359348-52359370 ATTATTTCTGGGTGTGTCTGAGG + Intergenic
1137934193 16:52618070-52618092 ATTATTTCTGGGTGTGTCTGTGG + Intergenic
1138883161 16:61041557-61041579 ATTGATCCTGGGTGTATCTGTGG + Intergenic
1138924928 16:61580023-61580045 ATTATTGCTGGGTGTGTCTGTGG - Intergenic
1139517507 16:67460501-67460523 ATTAACCCTGGGTTTACCTGGGG + Intronic
1146836602 17:36115916-36115938 ATTAATCCTGGGTGTGCCTGTGG + Intergenic
1147038178 17:37697547-37697569 ATTAATCATGGTCCTGTCTGGGG + Intronic
1148479434 17:47950374-47950396 ATTAACACTGGGCAGGGCTGCGG + Intergenic
1154367648 18:13726254-13726276 TTCAACCCTGGGCGTGTGTCCGG - Intronic
1159273900 18:66190790-66190812 ATTAATCCTGGATGTGTCTGTGG - Intergenic
1159608809 18:70503815-70503837 ATTAACCCTGGGGGTTGCGGGGG - Intergenic
1160269743 18:77373190-77373212 ATGGGCCCTGGGCGTGGCTGAGG - Intergenic
1165636380 19:37343739-37343761 ATTAACCCTGGGCTTGGCCATGG - Intronic
1165792104 19:38498959-38498981 ATTAGCCCTGGTCCTGTCAGAGG - Intronic
925773245 2:7305100-7305122 ATTAAACTTGGGAGTGTCTTTGG + Intergenic
928211270 2:29325557-29325579 CTTCATCCTGGGTGTGTCTGTGG + Intronic
929333911 2:40717007-40717029 ATTCATCCTGGGTGTGTCTGTGG + Intergenic
932457093 2:71856897-71856919 ATTAACCAGGTGCGTGTCAGTGG + Intergenic
935159124 2:100513904-100513926 ATTGTTCCTGGGTGTGTCTGTGG - Intergenic
937669347 2:124521900-124521922 ACAAACCCTGGTCTTGTCTGAGG + Intronic
938417114 2:131112813-131112835 GTTAACCCTGAGCGTGGCTGGGG + Intronic
940310401 2:152273231-152273253 ATTATTTCTGGGTGTGTCTGTGG + Intergenic
942190110 2:173461416-173461438 ATTGACACAGGGTGTGTCTGAGG - Intergenic
945042619 2:205754972-205754994 ATTTTCTCTGGGAGTGTCTGAGG + Intronic
1174043899 20:47719639-47719661 ATAAATCCTGGGGGTATCTGTGG + Intronic
1177969206 21:27767335-27767357 ATTATTTCTGGGTGTGTCTGAGG - Intergenic
1181009988 22:20034626-20034648 ATAACCCCTGGGGGTGGCTGCGG + Intronic
1181043656 22:20204580-20204602 GGTCACCCTGGGCGTGGCTGAGG + Intergenic
1182836228 22:33343736-33343758 AGTGACCCTGGGCTAGTCTGAGG - Intronic
1184161448 22:42699798-42699820 GTTACTCCTGGGTGTGTCTGGGG + Intronic
949638321 3:6008656-6008678 ATTGAACCTGGGTGTGTCTGTGG + Intergenic
950444618 3:13029345-13029367 ATTAACCCTGGGCGTGTCTGTGG - Intronic
953904303 3:46860847-46860869 GCTGACCCTGGGAGTGTCTGTGG - Intronic
958546413 3:95557984-95558006 ATTTACCCTGGGTGTGTCATAGG - Intergenic
961939793 3:130625128-130625150 ATGAACCCTGGATGTGGCTGTGG + Intronic
967959363 3:194908089-194908111 AGTGACCCTGGGCTTCTCTGAGG + Intergenic
969292269 4:6247625-6247647 ATTGATCCTGGATGTGTCTGTGG - Intergenic
969389167 4:6877815-6877837 ACTGATCCTGGGTGTGTCTGTGG - Intronic
969538626 4:7771995-7772017 ATGAGCCCTGGGCGGGTTTGTGG - Intronic
969874949 4:10129378-10129400 ATTGATCCTGGGTGTGTCTGAGG - Intergenic
970773750 4:19647841-19647863 ATTATTCCTGGGTGTGTCCGTGG - Intergenic
971976177 4:33691095-33691117 ATTGATCCTGGGTGTGTCTGTGG + Intergenic
971976189 4:33691257-33691279 ATTGATCCTGGGTGTGTCTGTGG + Intergenic
975249559 4:72162647-72162669 ATTGTTCCTGGGTGTGTCTGTGG - Intergenic
976555813 4:86450331-86450353 ATTAAGCTTTGGAGTGTCTGGGG - Intronic
978569142 4:110117371-110117393 ATTCAGCCTGAGTGTGTCTGAGG - Intronic
981247832 4:142560843-142560865 ATTGTTCCTGGGTGTGTCTGTGG - Intronic
984306400 4:177997324-177997346 ATTAATCCTGAGTGTGTCTAAGG - Intergenic
985675333 5:1228389-1228411 CATGACCCTGGGCGTGTCTCTGG + Intronic
986000955 5:3630162-3630184 AACAGCCCTGGGCGTGTCTATGG - Intergenic
986349722 5:6866448-6866470 GTTATTCCTGGGTGTGTCTGTGG + Intergenic
987382321 5:17296714-17296736 ATTATTTCTGGGTGTGTCTGTGG + Intergenic
987906397 5:24083171-24083193 ATTAATCCTGGGTGTCTGTGGGG + Intronic
988565624 5:32318108-32318130 ATTGATCCTGGGTGTGTCTTGGG - Intergenic
989071250 5:37513882-37513904 ATTGATCCTGGGTGTGTCTGTGG - Intronic
989331613 5:40266636-40266658 GTTGATCCTGGGTGTGTCTGTGG + Intergenic
989695094 5:44190937-44190959 ATGACCCCTGGGTGAGTCTGTGG + Intergenic
995377240 5:111489207-111489229 ATTCACCCTGAGTGTGTCAGGGG - Exonic
996065933 5:119079322-119079344 ATTAACCCTGGACAATTCTGGGG - Intronic
997281249 5:132647709-132647731 ATTAACCCTGTGGCTGCCTGAGG + Intergenic
997701381 5:135902585-135902607 ATTAACCTTGGCCGTGTGTCTGG + Intergenic
997741522 5:136258983-136259005 ATGAACCCTGAATGTGTCTGAGG - Intronic
1000106655 5:158066320-158066342 ATTACCCCTGGGCATGGCTGTGG + Intergenic
1002645975 5:180655069-180655091 ATTGTTCCTGGGCGTGTCTGAGG + Intergenic
1005221881 6:23596664-23596686 ACTAACACTGGATGTGTCTGTGG + Intergenic
1007764149 6:44151112-44151134 TATAACTCTGGGGGTGTCTGTGG + Intronic
1008834552 6:55809545-55809567 ATTAACCCTGGTTGTGGTTGTGG + Intronic
1010648924 6:78427615-78427637 ATTATTTCTGGGTGTGTCTGTGG + Intergenic
1011676559 6:89740244-89740266 ATGAACCCTGGGGGTGACTTTGG - Exonic
1012344117 6:98166666-98166688 ATTGATCCTGGGTGTGTCTGTGG + Intergenic
1017461595 6:154656142-154656164 ATTGATCCTGGCTGTGTCTGTGG + Intergenic
1017629486 6:156382707-156382729 ATCAGCCCTAGGAGTGTCTGAGG + Intergenic
1018540402 6:164873827-164873849 ATTATCTCTGGGACTGTCTGTGG - Intergenic
1018830362 6:167437980-167438002 CTTGTTCCTGGGCGTGTCTGAGG + Intergenic
1019505988 7:1391669-1391691 ATTAGCACTGGAGGTGTCTGAGG + Intergenic
1019506815 7:1395526-1395548 ATTAACCCTGGCGGTCTCCGGGG - Intergenic
1020976947 7:15018278-15018300 ATTGTTCCTGGGTGTGTCTGAGG + Intergenic
1021528063 7:21611031-21611053 ATTATTTCTGGGCATGTCTGAGG + Intronic
1023304883 7:38815572-38815594 ATTGCTCCTGGGTGTGTCTGAGG + Intronic
1024654952 7:51444187-51444209 ATTGATCCTGGGTGTGTCTGTGG - Intergenic
1024884808 7:54128332-54128354 ATTGATTCTGGGTGTGTCTGTGG - Intergenic
1030274956 7:107710648-107710670 ATTAACCCTGGGCTTCTTTGTGG - Intronic
1030818205 7:114062995-114063017 AGTCACTGTGGGCGTGTCTGTGG - Intronic
1035482491 7:159198446-159198468 ATTCACACAGTGCGTGTCTGTGG + Intergenic
1039383902 8:37113513-37113535 ATTGTTCCTGGGTGTGTCTGTGG - Intergenic
1040016954 8:42707670-42707692 CTTAACACTGGGTGTTTCTGAGG + Intronic
1045821810 8:106347089-106347111 ATTAAGCATGTCCGTGTCTGTGG + Intronic
1046965950 8:120165914-120165936 ATTATCCCTGGGTTTCTCTGAGG + Intronic
1048869247 8:138783619-138783641 ATTGATCCTGGGTGTGTCTGAGG - Intronic
1054859734 9:69937530-69937552 CTTAAACCTGGGTGTGTGTGAGG - Intergenic
1057618235 9:96612700-96612722 AATAACACTGGGAGGGTCTGAGG - Intronic
1062082434 9:134631293-134631315 ACTGTTCCTGGGCGTGTCTGTGG + Intergenic
1062603701 9:137332946-137332968 ATTGATCCTGGATGTGTCTGTGG + Intronic
1186897816 X:14022170-14022192 ATTAACCCTGGGTCTTCCTGAGG + Intronic
1187498303 X:19814910-19814932 ATTATCACTTGGCCTGTCTGTGG - Intronic
1187556729 X:20358876-20358898 ATTATTTCTGGGTGTGTCTGTGG - Intergenic
1189198658 X:39173189-39173211 CTAAACCCTTGGCGTGTCTAGGG - Intergenic
1192192553 X:69000529-69000551 CTTAATCCTGGGCATTTCTGAGG - Intergenic
1195881511 X:109597500-109597522 ATTGATCCTGGGTGTGTCTGTGG + Intergenic
1196083214 X:111655528-111655550 ATTGATCCTGGGTGTCTCTGTGG - Intergenic
1197477840 X:126945436-126945458 ATTGATCCTGGGTGTGTCTGTGG - Intergenic
1198412198 X:136382034-136382056 ATTGATCCTGGGTGTGTCTGTGG - Intronic