ID: 950444621

View in Genome Browser
Species Human (GRCh38)
Location 3:13029360-13029382
Sequence GGGTTAATACAGATAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950444618_950444621 -8 Left 950444618 3:13029345-13029367 CCACAGACACGCCCAGGGTTAAT 0: 1
1: 0
2: 0
3: 21
4: 121
Right 950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG 0: 1
1: 0
2: 2
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950444621 Original CRISPR GGGTTAATACAGATAGAACA TGG Intronic
902281043 1:15374712-15374734 GGGATGATGCAGATAAAACATGG - Intronic
909196049 1:72625143-72625165 GGGATAATACAGATTGTACCTGG - Intergenic
909956361 1:81783901-81783923 GAATTAATACAGATAGTACCTGG - Intronic
910615382 1:89192063-89192085 AAGTTAATACAGATATAACTTGG + Intronic
911327112 1:96481003-96481025 AGGTCAACACAGCTAGAACAGGG - Intergenic
913472069 1:119198135-119198157 GGGTTAATAAAGAAATAAAAAGG + Intergenic
913671348 1:121099169-121099191 GGGGAAGTACAGATAGAAAAAGG + Intergenic
914023117 1:143886589-143886611 GGGGAAGTACAGATAGAAAAAGG + Intergenic
914661603 1:149794531-149794553 GGGGAAGTACAGATAGAAAAAGG + Intronic
918232875 1:182551516-182551538 GGTTTAATGGAGATAGAGCAGGG - Intronic
919074903 1:192801143-192801165 ATGTTAATACAGATAGAAAGTGG - Intergenic
922137875 1:222850331-222850353 GGGTTTAAAAAGAGAGAACAAGG - Intergenic
924103264 1:240625701-240625723 GAGTATTTACAGATAGAACATGG + Intergenic
924580655 1:245321133-245321155 GGATGAATAGAGAGAGAACAGGG - Intronic
924932716 1:248745047-248745069 GGGTTAACACAGAAGGACCAGGG - Intronic
1063802960 10:9602457-9602479 GGGTTAAAACAAAAAGAACCTGG + Intergenic
1067253719 10:44613790-44613812 GGGTCAATGAAGATATAACAAGG + Intergenic
1068371376 10:56120412-56120434 GGGTGTATACAGATATAAGATGG + Intergenic
1071260314 10:83913452-83913474 TGGTTAATACAGGTAAAGCATGG + Intergenic
1076538630 10:131199186-131199208 GGGTGAGTACAGATAGGCCACGG - Intronic
1078333742 11:10447320-10447342 GAGTTAATACAGAGAGAAGATGG + Intronic
1078796945 11:14601569-14601591 GGCTTAATGTAAATAGAACAAGG + Intronic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1086057702 11:82666700-82666722 GGGTTAATTCAGCTACAAGATGG + Intergenic
1086152688 11:83629647-83629669 GGTATAATAAAGAAAGAACAAGG - Intronic
1087554546 11:99699037-99699059 TGGTTAATAAAGGTAGATCATGG + Intronic
1088429643 11:109744951-109744973 TGGAAAATACAGAGAGAACATGG - Intergenic
1090047946 11:123352357-123352379 AGGTTAACACAGGTAGAAAATGG - Intergenic
1090883913 11:130859571-130859593 GAGTTAATCCACATAGAGCACGG + Intergenic
1093267478 12:17020655-17020677 GGGTTATTAAAGTTAGTACATGG + Intergenic
1095886124 12:47190342-47190364 GGGTTAGAACAGATGGAACTTGG - Intronic
1097391809 12:59024355-59024377 GGTTTAAACCAGAGAGAACAAGG - Intergenic
1098627160 12:72686014-72686036 GTTTGAATACAGAGAGAACAGGG + Intergenic
1101238374 12:102813003-102813025 GGGTTAATATATATAAAACTTGG + Intergenic
1102911365 12:116716874-116716896 GGGTTTCTATTGATAGAACAGGG + Exonic
1105731193 13:23218745-23218767 GTATTAATACAAATAGACCAAGG + Intronic
1108521080 13:51247450-51247472 GAGTTCATACATGTAGAACATGG + Intronic
1111105649 13:83642420-83642442 GGGTAAATACAGATATTCCAAGG + Intergenic
1115070536 14:29317208-29317230 TGGCTAATACAGAAAGCACAAGG + Intergenic
1116175093 14:41459083-41459105 GAGTTAATCCAGACAGAACTGGG - Intergenic
1120741441 14:88113139-88113161 GGGTTAATACACTTAGGATAGGG + Intergenic
1125424323 15:39534030-39534052 GAGATAATACAGGCAGAACAGGG + Intergenic
1127153553 15:56104704-56104726 GCCTTAATACAGAAAGAATAAGG + Intronic
1127717618 15:61664975-61664997 GAGTTAATAGGGATAGAACATGG + Intergenic
1129494529 15:75965351-75965373 GGGTTTATGCAAATAGAAAAAGG + Intronic
1134212610 16:12290328-12290350 GGGTTCATAAAAAAAGAACAGGG - Intronic
1135882553 16:26272653-26272675 GGTTTAACACAGAAAGAAGAAGG - Intergenic
1138126033 16:54439328-54439350 GGGGTGATAGAGATAGATCATGG + Intergenic
1139432662 16:66919394-66919416 GTATTAATAGAGATAGCACATGG - Intergenic
1140014838 16:71171939-71171961 GGGGTGATCCAGATAGAACTGGG + Intronic
1149840717 17:59962273-59962295 GGATTAAAAGAGTTAGAACACGG - Intronic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1166420130 19:42630229-42630251 GGGTTCATAGGGATAGAACATGG + Intronic
1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG + Intronic
926799125 2:16643648-16643670 GGGCGAATACAGATAGAACTGGG - Intronic
931176944 2:59863667-59863689 GGGTGGATACTGAAAGAACAAGG - Intergenic
931523597 2:63127728-63127750 GGAGTAATACATATAGAATAGGG - Intronic
931936925 2:67208976-67208998 AGGTTAATACTGATAGAACAAGG + Intergenic
933994470 2:87657747-87657769 GGTTTCATACATTTAGAACACGG - Intergenic
934076245 2:88430977-88430999 GTGTTGTTACAGATAGAACAAGG - Intergenic
934495720 2:94795653-94795675 GTGTTAACACAGAAAGAAAATGG - Intergenic
936299388 2:111293166-111293188 GGTTTCATACATTTAGAACACGG + Intergenic
938716151 2:134023683-134023705 GAGATAATACATCTAGAACAGGG - Intergenic
944509330 2:200449001-200449023 GGGCAAATACACATATAACATGG + Intronic
948484985 2:238274791-238274813 GGGTTGATACAGACAGAACAAGG - Intronic
1169513108 20:6286305-6286327 GGGTTAATAAAAACAGGACATGG + Intergenic
1172002776 20:31793215-31793237 GGGTTAACGGAGATAGGACAAGG - Intronic
1174760891 20:53206465-53206487 GGGTTAAAACAAATAGAGAAGGG + Intronic
1175261620 20:57678043-57678065 GGGTGGATACAGTTAGAAAAGGG + Intronic
1177353734 21:19979922-19979944 AGGTTAACACAGTTAGAATAGGG - Intergenic
1177401916 21:20615506-20615528 TGGACAATACAGATAGTACATGG - Intergenic
1179393378 21:41014417-41014439 GGATTAAAACAGAAAGAGCATGG + Intergenic
1179659465 21:42865201-42865223 GGGTAAACACAGAGAAAACAAGG + Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
949255379 3:2039003-2039025 GGGTTATTACTGATAAAACCTGG - Intergenic
950315546 3:11998812-11998834 GGATTAAATCAGATAGCACATGG + Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
952628356 3:35435087-35435109 GGGTTAATACAAATAGTTGAAGG + Intergenic
953597974 3:44336199-44336221 GTGTTAATACAGCTAGAAGGTGG + Intergenic
954330819 3:49889381-49889403 GGGTTAGAACAGAGAGAACCAGG - Intronic
955172115 3:56576788-56576810 GGATTAATACACATACACCATGG - Intronic
955644001 3:61117148-61117170 AGATTAATACAAATAGAAAATGG + Intronic
956235444 3:67065108-67065130 AGGTTAATACTGATATTACATGG + Intergenic
957651878 3:83017951-83017973 GGTTTTCTACAGAGAGAACAAGG - Intergenic
959850462 3:111080948-111080970 GAGTTTAGACAGATAAAACAGGG + Intronic
960196864 3:114779168-114779190 GTGTTAAAGCAAATAGAACAAGG - Intronic
960390711 3:117074342-117074364 AGCTCAATAAAGATAGAACAGGG + Intronic
960529134 3:118743679-118743701 AGGAGAGTACAGATAGAACATGG + Intergenic
964002951 3:151798102-151798124 GGATGAATAAAGTTAGAACATGG - Intergenic
964331135 3:155604588-155604610 GGTTTAATACAAATAGAAAAAGG - Intronic
964828748 3:160859587-160859609 GAGTGAATACAGCTAGACCAGGG - Intronic
965095752 3:164222995-164223017 AGGCTAAAACAGATAGAAAAAGG - Intergenic
966619981 3:181953070-181953092 GGGTAAGAACAGATAGCACAGGG + Intergenic
966986023 3:185181074-185181096 GGGTTGATACAGATGTAACAGGG - Intergenic
969325704 4:6442644-6442666 GAGTTAATTCATATAAAACACGG - Intronic
969579156 4:8053993-8054015 GCAATAATACAGATGGAACAAGG - Intronic
970109512 4:12621825-12621847 TGGCAAATACAGAAAGAACAAGG + Intergenic
970119457 4:12736977-12736999 AGGTTTATACAGTTAGTACATGG + Intergenic
971279088 4:25226504-25226526 GAGTTAATACAGACGAAACAAGG - Intronic
973834615 4:54796817-54796839 GGGTTCATACAGGTAGCATAAGG + Intergenic
978552425 4:109941688-109941710 GATTTTATACAGATAAAACAGGG - Intronic
980002263 4:127503708-127503730 GTGTTAAAACAGATAAAAGAAGG - Intergenic
984731495 4:183072441-183072463 GGGTAAACACAGATTGAACCAGG - Intergenic
988104190 5:26722396-26722418 GAGTTAAAACAGATAGAAATAGG - Intergenic
988694325 5:33604788-33604810 GGGTGCATACAGACAGAAGATGG + Intronic
989267435 5:39493244-39493266 GGTTTAATAAACATAAAACAAGG + Intergenic
992912024 5:81405152-81405174 GGGTTAATAAAGATACAGTATGG + Intergenic
993212552 5:84971796-84971818 GGATTAAAACAGATAGCTCAAGG - Intergenic
1000804587 5:165774039-165774061 TGGTAAATAGATATAGAACAGGG - Intergenic
1009717111 6:67412109-67412131 GGGCTAATAAAGATAGAAAAAGG - Intergenic
1010808945 6:80275956-80275978 AGGTTAAAAAAGATAAAACAGGG + Intronic
1011281941 6:85686501-85686523 GGGAAAAAACAGAGAGAACAGGG + Intergenic
1012950219 6:105510224-105510246 GGGTTTATGCAGAAAGAAGAGGG + Intergenic
1013442160 6:110181218-110181240 GTGTTAATACAGTGAGAAAAAGG + Intronic
1020711369 7:11609513-11609535 GGTTTATTTCAGATAGAACTGGG + Intronic
1022252853 7:28626384-28626406 GGGTTAACACACATAAAACTTGG - Intronic
1023935703 7:44738299-44738321 GTGTTTATACAGATGGAACTGGG - Intergenic
1024095591 7:45980084-45980106 GGGCTAATACAGGTAACACAGGG + Intergenic
1027584724 7:80044258-80044280 GGGTAAATACAGATACAAGGAGG + Intergenic
1028271593 7:88797530-88797552 GGATTAAACCAGAGAGAACATGG + Intronic
1032329035 7:130960279-130960301 TGGTTACTCCACATAGAACATGG + Intergenic
1033960966 7:146912593-146912615 GGGATATTACAAATAAAACATGG - Intronic
1038941043 8:32306288-32306310 GGGTTGATACAGAAAGAAACTGG - Intronic
1039158114 8:34585960-34585982 TGCTTCATTCAGATAGAACATGG + Intergenic
1043400198 8:79877084-79877106 GGGTTAGTGCAGAGAGGACAAGG - Intergenic
1044119040 8:88371319-88371341 AGGTTAATAAACATAGGACATGG - Intergenic
1044772885 8:95655793-95655815 GGGTTAATCGGGATAGAACCAGG - Intergenic
1046713984 8:117547230-117547252 GAGTTACTACATTTAGAACAGGG - Intergenic
1047358811 8:124148537-124148559 GGGTTAAAAAAGATAAAATAAGG - Intergenic
1050592577 9:7175258-7175280 AGGGAAATACAGATAGCACACGG - Intergenic
1051452888 9:17216779-17216801 GGCTTAATACACATGGGACAGGG - Intronic
1052026415 9:23577891-23577913 GGGGTTATAAAGATTGAACATGG + Intergenic
1058170005 9:101669277-101669299 GGTTCAATCCAGAGAGAACATGG + Intronic
1186419908 X:9417344-9417366 GGGTGAAGAAAGATGGAACAAGG - Intergenic
1187489715 X:19739612-19739634 GGGGTATCACAGATAGAACAAGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188975729 X:36673028-36673050 AGGTTAATACACTTGGAACAAGG - Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1194397008 X:93398790-93398812 TGGTAAATACAGAAAGAACCAGG + Intergenic
1200804290 Y:7416310-7416332 AGGTTTATAGAGATAGAAGAAGG + Intergenic
1202233602 Y:22682863-22682885 GAGGTAATATACATAGAACAAGG - Intergenic
1202309554 Y:23513295-23513317 GAGGTAATATACATAGAACAAGG + Intergenic
1202561247 Y:26157297-26157319 GAGGTAATATACATAGAACAAGG - Intergenic