ID: 950445510

View in Genome Browser
Species Human (GRCh38)
Location 3:13035189-13035211
Sequence CTGGATGTGGATTAGGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950445510_950445517 10 Left 950445510 3:13035189-13035211 CCCGGCTCCTAATCCACATCCAG 0: 1
1: 0
2: 1
3: 17
4: 171
Right 950445517 3:13035222-13035244 GTCCCCTGACCTCCTAAGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950445510 Original CRISPR CTGGATGTGGATTAGGAGCC GGG (reversed) Intronic
900971521 1:5994668-5994690 TTGGGTCTGGATTTGGAGCCTGG + Intronic
901379326 1:8862520-8862542 CTGTTTGTGGATGTGGAGCCAGG - Intronic
901929096 1:12585619-12585641 CTGGAGGGGGAAGAGGAGCCAGG - Intronic
902469967 1:16642485-16642507 CTGGGTGTGGAGTAGGTGCCAGG + Intergenic
902624871 1:17670775-17670797 GGGGATGTGGACTAGAAGCCAGG + Intronic
904309866 1:29621995-29622017 CTGGAAGTGGAGTAGGATCTGGG - Intergenic
905242048 1:36587766-36587788 CTAGGTATGGCTTAGGAGCCTGG + Intergenic
906197481 1:43937818-43937840 CTCCATGTGGATAAGGAGGCAGG + Intergenic
906294859 1:44643446-44643468 ATGGATCTGGCTGAGGAGCCTGG + Intronic
910303145 1:85730626-85730648 CTGGAAGTTGATTAGGTTCCTGG + Exonic
910582691 1:88845989-88846011 CTTGAAGTGCATTAGGAGGCCGG - Intergenic
910718082 1:90255037-90255059 AAGGATGTGGATGAGGAGCAGGG + Intergenic
914255611 1:145959753-145959775 CAGGGTGTGAATAAGGAGCCAGG + Exonic
915014350 1:152719340-152719362 CAGGAGGTGGATTCAGAGCCAGG - Intergenic
916520878 1:165562640-165562662 CAGAATCTGGATTAGAAGCCTGG + Intronic
916663940 1:166948405-166948427 CTGGACTTGGATTAGGATCTGGG - Intronic
917685537 1:177412033-177412055 CTGGATGTGGATGCAGAGCTAGG - Intergenic
920210480 1:204324695-204324717 TTGGAAGTCGATTAGGATCCTGG + Intronic
920836241 1:209513695-209513717 CAGGATGTGGAATAGGGGCACGG - Intergenic
922515007 1:226200941-226200963 CTGGATGTGGAGTAGGAGCTGGG - Intergenic
924195629 1:241604216-241604238 CTGGATGTGGTTTGGGAGGGGGG + Intronic
1063282517 10:4645769-4645791 CTGAATGTGGAGGAGGAGCCAGG - Intergenic
1064735483 10:18377999-18378021 CTTCATGTTAATTAGGAGCCAGG + Intronic
1066174030 10:32885264-32885286 ATGGATGTGGATTATGAGCTGGG + Intergenic
1066986666 10:42474756-42474778 CTGAAAGTGGATTTGGAGCAAGG - Intergenic
1068912071 10:62389171-62389193 CTGGATGTGGATAAAGATCCAGG + Intronic
1068949040 10:62759182-62759204 CTGTTTGTGGATTTGGAGCCAGG + Intergenic
1069813409 10:71178867-71178889 TTGGATGTGGGTGGGGAGCCAGG + Intergenic
1070741713 10:78907654-78907676 CTGGATGTGCATGGGGTGCCCGG - Intergenic
1070783077 10:79148624-79148646 CTGAATGTGGATTCTGGGCCGGG + Intronic
1070789754 10:79181973-79181995 CTGGAGGAGGAGGAGGAGCCAGG + Intronic
1073788485 10:106915877-106915899 CTGGAGGAGAATTTGGAGCCAGG - Intronic
1073966339 10:108994699-108994721 CTGGATGTGCTTTATGAACCTGG - Intergenic
1075747236 10:124736435-124736457 CTGGGTGAGGAGAAGGAGCCTGG - Intronic
1076237091 10:128871774-128871796 CTGGAAGTGGAGTGGAAGCCAGG + Intergenic
1076327439 10:129637243-129637265 AAGGATGTGTCTTAGGAGCCTGG + Intronic
1076806816 10:132862891-132862913 GTGGATGTGGCTGAGAAGCCAGG + Intronic
1078147588 11:8732193-8732215 CTGCATATGGATTTGGAGCTGGG - Intronic
1079456693 11:20642657-20642679 ATGGATGTGGATTAGGGGAAAGG + Intronic
1080197702 11:29631547-29631569 CTGGATATTGATTGGGAGCAAGG + Intergenic
1080758499 11:35225352-35225374 CTGGCTGGGGTTTAGAAGCCAGG - Intronic
1083327310 11:61879366-61879388 CAGGAGGTAGATAAGGAGCCAGG + Exonic
1083900659 11:65641785-65641807 CTGGCTGGGGGTGAGGAGCCAGG - Intronic
1086114794 11:83237481-83237503 CTGCATGTGGATTAGAAGGCTGG + Intronic
1092062706 12:5564258-5564280 AGGGATGTGGCTTAGCAGCCAGG - Intronic
1093415895 12:18920280-18920302 GTGGTGGTGGATTAGGAGCTGGG - Intergenic
1093932706 12:24970193-24970215 CTGCATGTGCATTAGGAGGATGG - Intergenic
1096653195 12:53072347-53072369 GTGGGAGCGGATTAGGAGCCAGG - Intronic
1100371324 12:93971544-93971566 CTGGAAGTAGATTAGGAGCTAGG - Intergenic
1103872092 12:124099432-124099454 CTAGATCTGAATTAGGAGCCTGG - Intronic
1103995703 12:124828672-124828694 CTAGACGTGGATACGGAGCCTGG - Intronic
1104273653 12:127305259-127305281 CTGGATGTGAGGGAGGAGCCAGG + Intergenic
1104854247 12:131894738-131894760 CCGGATTCGGATTAGCAGCCCGG + Exonic
1104998414 12:132673556-132673578 CGGGATGTGGCTTACGTGCCTGG + Exonic
1105697912 13:22908685-22908707 GTGGACGTGGATTTGGAACCAGG - Intergenic
1107471464 13:40695264-40695286 CAGGATGTGGATTAGGAGAGAGG + Intergenic
1111184862 13:84720432-84720454 CAGGAGGTGGATGGGGAGCCAGG - Intergenic
1111595320 13:90403814-90403836 CTGGAGGGGGATGAGGAGGCAGG - Intergenic
1112760210 13:102686845-102686867 CAGGCTGTGGTTTAGGTGCCTGG - Intronic
1120231103 14:81842726-81842748 CTGGGTGTTCATTATGAGCCAGG - Intergenic
1121254459 14:92521059-92521081 CTGGATGATGATTAGGAGGATGG - Intronic
1122169686 14:99862054-99862076 CTGGAGGAGGCTGAGGAGCCAGG - Intronic
1122388673 14:101365593-101365615 CTTGAGCTGGCTTAGGAGCCTGG - Intergenic
1127993549 15:64137916-64137938 CAGGATGTGGTTTAGGAACTGGG + Intronic
1129779215 15:78258984-78259006 CTGGAGGTTGAGAAGGAGCCAGG - Intergenic
1130650092 15:85757532-85757554 CAGAATGTGGATTTGGAGCTAGG - Intergenic
1132517493 16:372598-372620 CTCCATGTGGGTAAGGAGCCGGG - Exonic
1133206658 16:4238171-4238193 CTGGATTTGGGTTTGGAGCAGGG + Intronic
1133217447 16:4301570-4301592 CTGGAAGTAGATTAAGGGCCAGG - Intergenic
1135956912 16:26963460-26963482 ATGGATGTGTAGCAGGAGCCTGG + Intergenic
1136252020 16:29011616-29011638 CTGGACCTGGATGTGGAGCCTGG - Intergenic
1138108124 16:54301780-54301802 CTGGGTGTGGAGTAGAATCCAGG + Intergenic
1141908245 16:87041614-87041636 CAGGATGTGGAGGAGGAACCAGG - Intergenic
1143680908 17:8475360-8475382 CTTGATGTGGCTGAGGAGTCGGG + Exonic
1146126272 17:30234000-30234022 CTGGAGGGGGGTTAGGAGCATGG - Intronic
1146704716 17:34992612-34992634 CAGGAGGTGGAGAAGGAGCCGGG + Exonic
1147685226 17:42283220-42283242 ATGGATGAGGATGAGAAGCCAGG + Intergenic
1147794182 17:43030906-43030928 CTGGATGTGGTGTTGGAGCTGGG + Intergenic
1151575555 17:74951120-74951142 CTGGCTTTGGGTTAGGAGGCTGG + Exonic
1151644739 17:75422731-75422753 CTGAATGTGCATTATGAGCCAGG + Intergenic
1152369878 17:79880099-79880121 CTGGTTGTGGTTTAGGATACAGG + Intergenic
1157114945 18:44853725-44853747 CAGGATTTGGATTAGAATCCAGG + Intronic
1158828560 18:61252319-61252341 CTGGATGTGGTTTACAATCCAGG + Intergenic
1158886735 18:61835354-61835376 ATGGCTTTGGAATAGGAGCCAGG + Intronic
1160231357 18:77052037-77052059 CTGGAAGAGGATGAGGAGGCTGG + Intronic
1161960549 19:7520680-7520702 CTGGGGGTGGATCTGGAGCCGGG - Exonic
1162935629 19:13980194-13980216 CTGGGTGTGGATTTGGGGGCTGG + Intronic
1162958365 19:14112332-14112354 CTGGCTGTGGCTTAGGCCCCCGG + Intronic
1164728986 19:30487398-30487420 CTGAATGTGGACCAGGGGCCGGG + Intronic
926104338 2:10141103-10141125 CTGGAAGTTGCTTAGGAGCTTGG + Intergenic
927491500 2:23524222-23524244 AGAGATGTGGATGAGGAGCCGGG - Exonic
930999814 2:57765987-57766009 GTAGATGTGGATTAGGAAGCAGG + Intergenic
931925238 2:67065268-67065290 CTGGATTTGGTTCAGGAGCCTGG + Intergenic
932143360 2:69298408-69298430 CTCCATGTGGCTTAGGAGCCTGG + Intergenic
937053505 2:118911701-118911723 CTGGATATGGATTAGTGACCAGG + Intergenic
937877783 2:126838214-126838236 CAGGGTGTGGATGAGGAGGCAGG - Intergenic
940082476 2:149819715-149819737 CTGGAAATGGATTGGGAGTCAGG - Intergenic
940123527 2:150295381-150295403 CTGAAGGTGGAAGAGGAGCCAGG - Intergenic
941463097 2:165794064-165794086 CTGGACGTGGGCTAGGCGCCAGG + Exonic
942075212 2:172351272-172351294 CTGCCTGTGGATAATGAGCCAGG + Intergenic
942321681 2:174741715-174741737 CTGGATGGGGAAGAGGAGGCAGG - Intergenic
945257004 2:207811280-207811302 CGGGATGTGGATTAGAACTCTGG + Intergenic
946631714 2:221676657-221676679 GTGGATGTTGATTACGTGCCAGG - Intergenic
946923933 2:224607397-224607419 TCGGATGTGGACTAGGACCCTGG - Intergenic
948186259 2:236023822-236023844 CTGGATGGGCCTCAGGAGCCTGG + Intronic
948540344 2:238686842-238686864 CGTGATGTGGAGTGGGAGCCCGG + Intergenic
948884159 2:240874665-240874687 CTGGGTGTGAGTCAGGAGCCTGG + Intronic
1172631601 20:36382116-36382138 CTGGAGGTGGAGAAGCAGCCTGG + Intronic
1172645885 20:36469300-36469322 CAGGATGCAGGTTAGGAGCCTGG - Intronic
1173622166 20:44445088-44445110 TTGGATGTGGATTAGCCCCCTGG + Intergenic
1175260937 20:57673707-57673729 CTGGCTGTGGACCAGGTGCCAGG - Intronic
1175500373 20:59445868-59445890 CTGGGAGTAGAGTAGGAGCCAGG + Intergenic
1179276689 21:39898260-39898282 GTGGATGTGGATGAGGGGGCCGG + Intronic
1179842611 21:44087184-44087206 CTGGCTGAGGATTAGGAGATGGG + Intronic
1180726624 22:17951246-17951268 CTGGATTAGGATCAGGAGACAGG + Intronic
1184694321 22:46131261-46131283 CTGGATGTGGGCTAGGAGGGGGG - Intergenic
949765426 3:7521009-7521031 CTGTAGGTGGGTTAGGATCCAGG + Intronic
950445510 3:13035189-13035211 CTGGATGTGGATTAGGAGCCGGG - Intronic
952336018 3:32403627-32403649 CTGAAGGTGGATTTGGGGCCAGG + Intronic
952930801 3:38359789-38359811 CTTGGTGTGGATTCTGAGCCTGG + Intronic
953999863 3:47547509-47547531 CTGGATGTGGAGGCGGAGGCAGG - Intergenic
954299465 3:49691769-49691791 CTGGGTATGGAGTAGGTGCCAGG - Intronic
954347076 3:50009055-50009077 CAAGAGGTGGATAAGGAGCCAGG - Intronic
960056448 3:113279512-113279534 CTGGAGGAGGATGACGAGCCTGG + Intronic
961358234 3:126352155-126352177 CTGGATGTTGACCAGGAGCTGGG + Exonic
961452464 3:127008600-127008622 CTGGCTGTGGGTGTGGAGCCGGG + Intronic
961906001 3:130263952-130263974 CTGGAGGTGGCTGAGCAGCCGGG + Intergenic
962990274 3:140571803-140571825 GGGGCTGTGGATTAAGAGCCAGG + Exonic
965690397 3:171350326-171350348 CTGAATCTAGATTAGGAACCAGG + Intronic
966517142 3:180830247-180830269 AGGGATGGGGAGTAGGAGCCGGG - Intronic
968735309 4:2292058-2292080 CTGGATGTGACTGAGGAGCCTGG - Intronic
968869973 4:3236813-3236835 CTGGAAGTGGGTTAGGAGCTTGG + Intronic
969670163 4:8585792-8585814 CGGGATGGGGATGAGGAGGCTGG - Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977638219 4:99325132-99325154 CTGGCTGTGGCTGTGGAGCCTGG + Intergenic
982719578 4:158846490-158846512 CAGGATTTGAACTAGGAGCCTGG + Intronic
984801526 4:183721394-183721416 AATGATGTGCATTAGGAGCCTGG + Intergenic
985006847 4:185542745-185542767 CTAGATGTGCATCAGGAGACCGG + Intergenic
987089424 5:14498031-14498053 GTGGGTGTGGAGGAGGAGCCAGG + Intronic
988492000 5:31712799-31712821 CTGGAAAAGGATTTGGAGCCTGG + Intronic
989667144 5:43867601-43867623 CTGGAGTGGGATTAGGAGCTGGG + Intergenic
990439415 5:55829818-55829840 CTTTCTGTGCATTAGGAGCCTGG + Intergenic
991197735 5:63956028-63956050 CTGGATGTTGATTAATTGCCTGG - Intergenic
992015388 5:72569999-72570021 CTGAATGGTGAGTAGGAGCCAGG - Intergenic
996562209 5:124843092-124843114 CTGGAGGTGGTTAAGGAGCGAGG + Intergenic
997633751 5:135389714-135389736 CTGGATGGGGATTGGGAGCAAGG - Intronic
999943755 5:156573232-156573254 TTGGATTTGGATAATGAGCCTGG + Intronic
1001796590 5:174507229-174507251 GATGATGTGGATTTGGAGCCTGG - Intergenic
1002424563 5:179167538-179167560 CGGGATGGGGATCAGCAGCCTGG + Intronic
1004276866 6:14244346-14244368 CAGAATGAGGATTAGGACCCAGG + Intergenic
1004900436 6:20188677-20188699 CTGCATGTGCATTAGGAGGAGGG - Intronic
1006449357 6:34097166-34097188 TTAGATGGGGATGAGGAGCCAGG + Intronic
1007400463 6:41599786-41599808 CTGGATGTGGGTGTGGAGCCGGG - Exonic
1007917628 6:45575820-45575842 CTGTATCTGGATTAGGTGTCAGG + Intronic
1010499730 6:76582662-76582684 GTGAATGTGGATGAGAAGCCTGG + Intergenic
1019145844 6:169975230-169975252 CTCGATGTGGAAGAGGAGTCAGG - Intergenic
1023858412 7:44200970-44200992 CCGGAAGTGGATTGCGAGCCAGG + Intronic
1024888263 7:54169592-54169614 CTGCATGTGCATTAGGAGGATGG + Intergenic
1026095726 7:67345085-67345107 CTGCATGTGCATTAGGAGAATGG + Intergenic
1029667360 7:102004349-102004371 CTGGTGGTGGAATTGGAGCCTGG + Intronic
1030897118 7:115074211-115074233 CTGGACTTGGATAAGGAGCTGGG - Intergenic
1031177508 7:118371477-118371499 TTGGATGTCTATTAGAAGCCTGG - Intergenic
1033834885 7:145298186-145298208 CTGGATGTTGTTTTGGAGCTTGG + Intergenic
1035643383 8:1200338-1200360 CTGAAGATGAATTAGGAGCCGGG - Intergenic
1037934295 8:22904251-22904273 CTGGAAGAGGAGAAGGAGCCAGG + Intronic
1042343434 8:67704024-67704046 CTGGAGGAGGATAAGGGGCCTGG - Intronic
1042465003 8:69118995-69119017 CTGGATGTGGAATGGGAGAGAGG - Intergenic
1047531246 8:125678779-125678801 GTCGATGTGAGTTAGGAGCCAGG + Intergenic
1049684628 8:143934375-143934397 CTGGATGTGGAGAAGGAGTGGGG - Exonic
1052915907 9:33924206-33924228 CTGGATATGGATTATTAGCTAGG + Exonic
1056563809 9:87756861-87756883 CTTGAGGTGGATGAGGAGCAGGG - Intergenic
1056938693 9:90937188-90937210 CTGGATGTGGAAGGTGAGCCTGG + Intergenic
1057476735 9:95409220-95409242 CTGGAGGTGGCATAGGAGGCTGG + Intergenic
1057608666 9:96520903-96520925 CTGGATGTGGTGGAGGAGGCAGG - Intronic
1060517761 9:124276403-124276425 CTGGATCTGGCTTGGGAGCAGGG + Intronic
1060847185 9:126846922-126846944 CTGGGTGTGGAACAGGTGCCTGG + Intergenic
1061370385 9:130194368-130194390 CTGGCTGTGGGGTACGAGCCTGG + Intronic
1062462426 9:136667492-136667514 CTGGCTGTGCAGCAGGAGCCAGG - Intronic
1062465206 9:136677828-136677850 CTGGATGTGGATTTGGAAGTGGG - Intronic
1185455638 X:309322-309344 GTGGATGTGGATTTGGGGGCGGG - Intronic
1185521777 X:745657-745679 CTGGATGAGGATGAGGAGGGTGG - Intergenic
1185746616 X:2578445-2578467 ATAGATGTGGATTTGGAGCTAGG - Intergenic
1186256559 X:7728109-7728131 GTGGGTGGGGAGTAGGAGCCAGG - Intergenic
1186583868 X:10850564-10850586 CTGGAAGGGGATCATGAGCCAGG + Intergenic
1188861129 X:35258357-35258379 TTGGATGTGTACTATGAGCCAGG + Intergenic
1194272785 X:91839227-91839249 CTGTCTGTTGATTAGGAGTCAGG - Intronic
1197025266 X:121740290-121740312 CTGCATCTGGATTTGGAGACAGG + Intergenic
1198114974 X:133536257-133536279 CTGGATGTGGATGATGCGCCTGG - Exonic
1198331281 X:135625330-135625352 CTGGAGATGTGTTAGGAGCCAGG + Intergenic
1200590027 Y:5060634-5060656 CTGTCTGTTGATTAGGAGTCAGG - Intronic