ID: 950446573

View in Genome Browser
Species Human (GRCh38)
Location 3:13042241-13042263
Sequence TCCCATTGCCCTAGTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950446568_950446573 17 Left 950446568 3:13042201-13042223 CCTGCAATCGGGCAGGATCAGGG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 950446573 3:13042241-13042263 TCCCATTGCCCTAGTGGCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 159
950446566_950446573 18 Left 950446566 3:13042200-13042222 CCCTGCAATCGGGCAGGATCAGG 0: 1
1: 0
2: 1
3: 7
4: 91
Right 950446573 3:13042241-13042263 TCCCATTGCCCTAGTGGCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950446573 Original CRISPR TCCCATTGCCCTAGTGGCCA AGG Intronic
900763664 1:4489162-4489184 TCCCATTCTCCTGGTGGCCGTGG - Intergenic
901232851 1:7650930-7650952 TCCCATTGACCTTGTCGCCATGG + Intronic
904219592 1:28955223-28955245 TCGTATTGCCCTAGTGGGGAAGG + Intronic
904603293 1:31685253-31685275 TGCCATTTCCCCAGTGCCCATGG + Intronic
904827323 1:33281914-33281936 GCCCATTGCCCTCGGGGTCACGG + Intronic
907522595 1:55033941-55033963 TCCCATAGCCCCAGAGGGCAAGG - Intergenic
915384907 1:155481714-155481736 TACTGTTGGCCTAGTGGCCAAGG - Exonic
915472531 1:156134629-156134651 GTCCCTTGCCCTAGTGGACAGGG + Intronic
919062637 1:192652922-192652944 TCCCATTGCCCAAGTGATAAAGG - Intronic
920490573 1:206411316-206411338 ACTCAGTGCCCCAGTGGCCAAGG - Intronic
920820354 1:209374554-209374576 CCCTATTGACCTAGGGGCCAAGG + Intergenic
921632923 1:217456222-217456244 TCCCAAAGCCCAAGTGGGCATGG - Intronic
1063130675 10:3173900-3173922 TGACATTGCCCAAGTGCCCAAGG + Intergenic
1063175092 10:3543890-3543912 TCCAATTTCCCTTGAGGCCACGG - Intergenic
1064240080 10:13619174-13619196 GCCCATTGCCTGACTGGCCACGG + Intronic
1065488236 10:26255204-26255226 TCTCATGGCCCTCGTGGCCCCGG - Intronic
1067352310 10:45487397-45487419 TCGCCTTGCCCTAGTAGCCAAGG - Intronic
1069925959 10:71851070-71851092 TCCCCCTGCCCTAGTTGGCAAGG - Intronic
1074761914 10:116673360-116673382 TCCCATTGACCAAGAGGGCAAGG + Exonic
1076040197 10:127241070-127241092 TCCCAATGCTCTGGAGGCCAAGG + Intronic
1076573457 10:131448471-131448493 TCGCTTTGCCCAAGAGGCCATGG + Intergenic
1079194372 11:18312613-18312635 TCCCAGTTCCCTAGTTGCCAAGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1087593241 11:100219535-100219557 TCCCATTTACCTTGTGGCTAGGG + Intronic
1090137160 11:124210215-124210237 TCCCATGGCCCTGGTGCTCAGGG + Intergenic
1092529271 12:9331339-9331361 TCCCATGTCCCTGGTGCCCACGG + Intergenic
1101342925 12:103859022-103859044 ACCCTTTGCCCTGGTGGCCAGGG - Intergenic
1104805415 12:131586471-131586493 TCCCATGGCCCCAGTGCTCAGGG - Intergenic
1105068022 12:133216956-133216978 TCCCATTGTCAGAGAGGCCAGGG + Intergenic
1116897243 14:50328620-50328642 TCATATTGCCCTTGTGTCCAGGG + Exonic
1118600897 14:67470929-67470951 CCCCAATCCCTTAGTGGCCAGGG - Exonic
1118611740 14:67546748-67546770 TCCCAGTGACTTAGAGGCCAAGG + Intronic
1118744971 14:68767183-68767205 TCCCCTTACCCTCCTGGCCAGGG + Intergenic
1120410881 14:84154020-84154042 TCCTATTGCCCAAGTGATCAAGG - Intergenic
1121262084 14:92573765-92573787 TCCCATGGGCCTGGTGGCCAAGG + Intronic
1121406034 14:93719920-93719942 TCCCAGAGTCCTAGTGCCCACGG - Exonic
1122012455 14:98761295-98761317 GCCCATTGACCAAGAGGCCAAGG - Intergenic
1122497317 14:102167469-102167491 TCCCAGTGCTCTGGAGGCCAAGG - Intronic
1123122876 14:105926287-105926309 TCCCATTGCCCACCTGGCCCTGG + Intronic
1123405519 15:20017707-20017729 TCCCATTGCCCACCTGGCCCTGG + Intergenic
1123514851 15:21024355-21024377 TCCCATTGCCCACCTGGCCCTGG + Intergenic
1123663258 15:22585148-22585170 TGCCATTGCCCTGCTGGCCGTGG + Intergenic
1124259357 15:28174575-28174597 TGCCATTGCCCTGCTGGCCGTGG + Exonic
1124317087 15:28679586-28679608 TGCCATTGCCCTGCTGGCCGTGG + Intergenic
1124566360 15:30817899-30817921 TGCCATTGCCCTGCTGGCCGTGG - Intergenic
1125069850 15:35540939-35540961 TCCCTTATCCCTTGTGGCCAGGG - Intronic
1126346215 15:47696998-47697020 TCCCATTGCAGTAGAGGCCTAGG - Intronic
1127052987 15:55104031-55104053 TCCCATTGCCACAGTGCACATGG - Intergenic
1127569019 15:60222552-60222574 GGCCATTGCTCTAGTAGCCAAGG - Intergenic
1132865918 16:2092680-2092702 TCCCACTGCCCTGCTGGCCACGG + Intronic
1137569688 16:49557432-49557454 TCCCCTAGCCCTGGTGGCCCCGG - Intronic
1137817262 16:51410323-51410345 ACCCAGTGGACTAGTGGCCAAGG + Intergenic
1138596223 16:58030448-58030470 TCCCATGGCCCTCGTGGGAATGG + Intronic
1139675056 16:68517780-68517802 TCCCATTCTCCGAGTGGCCTGGG + Intergenic
1139805744 16:69564329-69564351 TCACATTGCCCAACAGGCCAAGG - Intergenic
1140025846 16:71289550-71289572 TTCCGTTGCCATAGTGGCCGGGG - Exonic
1146553485 17:33802748-33802770 TGCCGTTGGCCTAGAGGCCAGGG + Intronic
1151400751 17:73854407-73854429 TCCAATTAACCAAGTGGCCATGG + Intergenic
1152058486 17:78050877-78050899 TCCCATCCCCCAAGTGTCCAAGG - Exonic
1153137552 18:1934052-1934074 GCCCATGGACATAGTGGCCATGG - Intergenic
1156777588 18:40811543-40811565 GACCAATGCCTTAGTGGCCATGG + Intergenic
1159797403 18:72861842-72861864 TCCCATTGGCATAGTGGAGATGG - Intronic
1160513722 18:79466979-79467001 TCCCCTTGCCCAGGTGGCCCCGG + Intronic
1162249016 19:9426877-9426899 TCCCATTGTCATAGTACCCATGG + Intronic
1162724189 19:12680115-12680137 GCCCATTGACCCAGAGGCCAAGG + Intronic
1163126355 19:15246332-15246354 TCCCAGTTCCCTAGTGTGCAGGG - Intronic
1165152075 19:33766782-33766804 TTCCATTGCCCAACAGGCCAGGG - Intronic
1167160910 19:47766511-47766533 ACACATGGCCCTAATGGCCAGGG - Intergenic
1168246259 19:55114324-55114346 CCCAATTGCCTTAGTGGCTAGGG - Intronic
925915174 2:8599851-8599873 TCCCCTTGCCCCAGTGGACTTGG - Intergenic
926205313 2:10831229-10831251 TCCCCTTGACCCCGTGGCCAGGG + Intronic
926336700 2:11868310-11868332 TGCCACTGCCCAAGTGCCCAAGG + Intergenic
926487707 2:13483192-13483214 TCTCATTTCCCAAGTGGTCAAGG + Intergenic
926749194 2:16185143-16185165 TCCCATTGCCCTGGGGAACAGGG + Intergenic
927575542 2:24199204-24199226 TGTCATTCCCCTATTGGCCAGGG + Intronic
928322610 2:30295504-30295526 TACCCTTTCCCTATTGGCCAGGG + Intronic
928427388 2:31190420-31190442 TCCAATTGCCCTCTTTGCCATGG + Intronic
929116146 2:38445991-38446013 TCCCATGGCTCTAGGGGCCAAGG - Intergenic
929263297 2:39891113-39891135 GGCCATTGCCCTGGTGTCCAAGG + Intergenic
929880431 2:45832285-45832307 TCTCATTGCTCTTGTGTCCAAGG + Intronic
933659465 2:84915815-84915837 GCCCAGAGCCCTGGTGGCCATGG + Intergenic
934197407 2:89850848-89850870 TCCCACTACCTTAGGGGCCAAGG + Intergenic
935492230 2:103735118-103735140 ACACACTGTCCTAGTGGCCAAGG - Intergenic
937225616 2:120367175-120367197 TCCCATTCCCCTGGTGACCCAGG - Intergenic
937327394 2:120999247-120999269 TCGTATTGCCCTAGTGGCTAAGG - Intergenic
943388691 2:187234080-187234102 TCCCAGTTCCATAGAGGCCAGGG - Intergenic
944913513 2:204333690-204333712 TCCCATGGCCTCTGTGGCCAGGG + Intergenic
944941446 2:204632634-204632656 GCCCAAGGCCCTGGTGGCCAGGG + Intronic
946024633 2:216664528-216664550 TCCCATTTTCCTAGGAGCCAGGG - Intergenic
947729416 2:232419842-232419864 TCCCATAGCCCAGGTGGCCCAGG - Intergenic
1168761886 20:354884-354906 TCCCCACGCCCCAGTGGCCAGGG - Intronic
1169226982 20:3863058-3863080 TCCCACTGCCCTATAGGCCCTGG - Intronic
1171172848 20:23031352-23031374 CCCCATAGCCCATGTGGCCATGG + Intergenic
1171960317 20:31488711-31488733 TCCCCTTCCCTTCGTGGCCAGGG - Intergenic
1172775142 20:37402918-37402940 TCCCTCTGCCCTGGTGGCCTTGG + Intronic
1173846135 20:46189850-46189872 TGCCATTGCCCTTGTGGCAGTGG + Intronic
1175833841 20:61981207-61981229 TCCCTTTGCCCTGGTGGCCTTGG - Intronic
1176209745 20:63913349-63913371 TCCCCTTGCCCCAGGGTCCAGGG + Intronic
1177905995 21:26971920-26971942 TTCCATTTCCCTACTTGCCAGGG - Intergenic
1178594712 21:33942825-33942847 TTCCATTCCACAAGTGGCCAGGG + Intergenic
1179397956 21:41058509-41058531 GCTCTTTGCCCCAGTGGCCAAGG - Intergenic
1181640007 22:24191341-24191363 TCCCTTTGCCCTTCTGCCCAAGG - Intergenic
1184392551 22:44212778-44212800 CCCCATTGACCTAGGGGCCCAGG - Intronic
1184415302 22:44348779-44348801 TCCCATTGCCCCAGTAGGCAAGG + Intergenic
1185267866 22:49914111-49914133 CTCCATTGCCCTCGTGGCCCAGG - Intronic
949610748 3:5701036-5701058 TGTCATTGCCCTATTGGCTAGGG + Intergenic
949655195 3:6209934-6209956 TCCCATTACCCTAGGGGAGATGG - Intergenic
950419005 3:12885767-12885789 TCCCATTGCTTCAGTGGCCTGGG - Intergenic
950446573 3:13042241-13042263 TCCCATTGCCCTAGTGGCCAAGG + Intronic
951401929 3:22243282-22243304 TTCCATTTACCTAATGGCCAAGG - Intronic
954160348 3:48717122-48717144 TCCTATGGCCCTAGTGCCCGAGG - Intronic
954225343 3:49177523-49177545 TCCCATGGCACTTGTGCCCATGG - Intergenic
955873324 3:63462919-63462941 ACTCATTTCCCTGGTGGCCAGGG - Intronic
966855114 3:184188595-184188617 GCCCATTTCCATAGTGCCCAAGG + Intronic
969507285 4:7595925-7595947 TCCCATTCCCCATGGGGCCAGGG - Intronic
969649935 4:8460030-8460052 TCACATGGCTCTAGTGCCCAGGG - Intronic
978471809 4:109076585-109076607 TTCCATGGACCCAGTGGCCAGGG + Intronic
980438555 4:132812799-132812821 TCTCATTCCCCTATTGGCTAGGG + Intergenic
981049152 4:140293791-140293813 TTCCATCACCATAGTGGCCATGG - Intronic
981311922 4:143305814-143305836 TTCCTTTTTCCTAGTGGCCATGG - Intergenic
984751901 4:183286212-183286234 CCCCATCTCCATAGTGGCCATGG - Intronic
986032731 5:3909146-3909168 TCCCCATGGCCTGGTGGCCATGG + Intergenic
988053403 5:26059551-26059573 CTCCTTTGCCCTAGTGGCTAAGG + Intergenic
988650093 5:33139604-33139626 TCCCTTTGCCATAGTTTCCATGG + Intergenic
990944099 5:61231815-61231837 TCACATTGCTCTGGTGGCCCAGG - Intergenic
993542765 5:89172850-89172872 TCCGACTGCCCTTGTGGCAAAGG - Intergenic
994835613 5:104848645-104848667 CCCCACTGCCCTAGAGGCCCCGG + Intergenic
998416624 5:141950891-141950913 TCCCATTTCCCTTGTGGTAATGG - Intronic
1002481776 5:179506145-179506167 TCCCAATGCCTTCGTGGCCCTGG + Intergenic
1002714233 5:181216501-181216523 TCCCAGAGTCCCAGTGGCCAAGG + Intergenic
1004217349 6:13715114-13715136 ACACATTGCCCTAGTGGAAAAGG + Intergenic
1006282899 6:33069514-33069536 TCCTCTTCCCCTAGTGGCCATGG - Intronic
1007344035 6:41214876-41214898 TGTCATTCCCCTAGTGGCTAGGG + Intergenic
1007970905 6:46051215-46051237 TACCATTGCCCCAAGGGCCAGGG - Intronic
1008913769 6:56764434-56764456 TCCCTTTGCACTAGTAGCCTGGG + Intronic
1009424184 6:63496354-63496376 TGTCATTGTCCTAGTGGCTATGG - Intergenic
1011513298 6:88125221-88125243 TGTCATTGCCCTATTGGCTAGGG + Intergenic
1013427850 6:110031229-110031251 TCTCATTCCTATAGTGGCCAAGG - Intergenic
1013979518 6:116113332-116113354 TCCCTTTGTCTTAGTGGCCATGG - Intronic
1014830416 6:126096598-126096620 TACCAGTGCCCTAATGCCCATGG - Intergenic
1016267376 6:142247957-142247979 TCCCATTGTCCTAGTTACCAAGG + Intergenic
1017485739 6:154900589-154900611 TCCTGATTCCCTAGTGGCCAGGG + Intronic
1018873767 6:167802857-167802879 TACCCATGACCTAGTGGCCAAGG + Intergenic
1018996438 6:168713998-168714020 GCCCAGCCCCCTAGTGGCCAGGG + Intergenic
1019294311 7:265964-265986 TCCCATGGCCCTAGAGGGCCAGG - Intergenic
1020084610 7:5303661-5303683 TCCCATTGCCTTCCTGGCCCGGG + Exonic
1023844822 7:44114656-44114678 TCCCATAGCCAGAGTGCCCAGGG + Intergenic
1024337699 7:48225982-48226004 CCCCATTGCCCTCGTGCCCCTGG - Intronic
1026796182 7:73367382-73367404 CACCATTGCCCCAGTAGCCATGG + Intergenic
1028587030 7:92462650-92462672 TACCATTGCCTTGGGGGCCAGGG - Intergenic
1030123376 7:106132482-106132504 TCCCATTGCCTAAGTGTCCAGGG + Intergenic
1035068375 7:156123957-156123979 TCCCACTGCCCCAGTGCCCTGGG + Intergenic
1035090811 7:156308439-156308461 TCTCATTGCCCCACTGGCCTGGG + Intergenic
1035416755 7:158695726-158695748 TCCTATGGCCCTAGAGGCCTGGG - Intronic
1035607382 8:938818-938840 TCTCATTGCCTCAGAGGCCAAGG + Intergenic
1039893383 8:41699271-41699293 TCCGCCTGCCCTAGTGGCTAGGG + Intronic
1041179411 8:55232154-55232176 TCCCCTGGCTCTTGTGGCCAAGG + Intronic
1041500692 8:58535236-58535258 TCCCATTGTCTTAGTGCTCAGGG + Intergenic
1045567935 8:103340149-103340171 TCGCTTTGTCCTAGTAGCCATGG + Intergenic
1047755599 8:127915993-127916015 CCCTATTGGCCTAGTGGCCAGGG - Intergenic
1056657430 9:88520882-88520904 TCCCCAGGCCCTAGTGCCCATGG + Intergenic
1058153509 9:101486873-101486895 TCCCCTCGCTCTAGTGTCCAGGG + Intronic
1058359528 9:104127182-104127204 TCACATTGCCCTCTTGCCCAGGG + Intronic
1061513144 9:131072899-131072921 TCCCATTGACCTGGTGACCTTGG + Intronic
1061569234 9:131466203-131466225 TCCTAGTGCCCTTCTGGCCAGGG + Intronic
1188860007 X:35244721-35244743 CCCCATTGCCCTGGTGCTCAGGG + Intergenic
1190106455 X:47564567-47564589 TCTCATTACCCTTGTGGCCCAGG + Intronic
1191008754 X:55738957-55738979 GAACATTACCCTAGTGGCCAGGG - Intronic
1192223703 X:69214516-69214538 TCACATTGCCATAGTGACAATGG - Intergenic
1196239006 X:113318251-113318273 TACCATTGCCCAAGTGGGCCTGG - Intergenic
1196301823 X:114057057-114057079 TCCCTTTGGCTAAGTGGCCAAGG - Intergenic
1197083026 X:122441174-122441196 TCCCATAGCCCTAGGACCCAGGG - Intergenic
1198567612 X:137920898-137920920 TCCTATTGGCATAGTGGCCAAGG + Intergenic
1199538488 X:148930791-148930813 TAGCACTGCCTTAGTGGCCATGG - Intronic
1199850694 X:151723309-151723331 TGCCATTGCCCCAGGGGCCCTGG + Intergenic
1200856631 Y:7945763-7945785 TACCACTGCCCTAGTAGTCAAGG + Intergenic
1201571860 Y:15423607-15423629 TTCCATTACACTAGTGGCCAGGG - Intergenic