ID: 950446704

View in Genome Browser
Species Human (GRCh38)
Location 3:13042796-13042818
Sequence TAGGACTGTCCAGCCAGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 193}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950446704_950446713 13 Left 950446704 3:13042796-13042818 CCGGCACTGGCTGGACAGTCCTA 0: 1
1: 0
2: 0
3: 9
4: 193
Right 950446713 3:13042832-13042854 GGCCCAGAGTGGCTGAGGCCAGG 0: 1
1: 0
2: 5
3: 53
4: 537
950446704_950446709 2 Left 950446704 3:13042796-13042818 CCGGCACTGGCTGGACAGTCCTA 0: 1
1: 0
2: 0
3: 9
4: 193
Right 950446709 3:13042821-13042843 CCCGCCTGGCTGGCCCAGAGTGG 0: 1
1: 0
2: 3
3: 34
4: 236
950446704_950446716 23 Left 950446704 3:13042796-13042818 CCGGCACTGGCTGGACAGTCCTA 0: 1
1: 0
2: 0
3: 9
4: 193
Right 950446716 3:13042842-13042864 GGCTGAGGCCAGGAAGACCCAGG 0: 1
1: 0
2: 2
3: 62
4: 690
950446704_950446712 8 Left 950446704 3:13042796-13042818 CCGGCACTGGCTGGACAGTCCTA 0: 1
1: 0
2: 0
3: 9
4: 193
Right 950446712 3:13042827-13042849 TGGCTGGCCCAGAGTGGCTGAGG 0: 1
1: 0
2: 12
3: 97
4: 627
950446704_950446717 24 Left 950446704 3:13042796-13042818 CCGGCACTGGCTGGACAGTCCTA 0: 1
1: 0
2: 0
3: 9
4: 193
Right 950446717 3:13042843-13042865 GCTGAGGCCAGGAAGACCCAGGG 0: 1
1: 0
2: 4
3: 37
4: 387
950446704_950446706 -8 Left 950446704 3:13042796-13042818 CCGGCACTGGCTGGACAGTCCTA 0: 1
1: 0
2: 0
3: 9
4: 193
Right 950446706 3:13042811-13042833 CAGTCCTACACCCGCCTGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950446704 Original CRISPR TAGGACTGTCCAGCCAGTGC CGG (reversed) Intronic
900236854 1:1597161-1597183 CAGGCCTGTCCTGCCAGTTCTGG - Intergenic
900796589 1:4712068-4712090 TAGGAGTGGACAGCCAGCGCGGG + Exonic
902558435 1:17260823-17260845 GAGGACTGGCCAGCCTGTGAGGG + Intronic
903121182 1:21217938-21217960 GAGCACTGTCCAGGCAGGGCTGG + Intronic
905043607 1:34979175-34979197 TAGGACTGCCCAGCAGCTGCAGG - Intergenic
905128575 1:35734097-35734119 TAGGACTGAGAAGCCAGTGAGGG + Intronic
906602605 1:47143086-47143108 TGGGACTGTAAAGCCAGTGTTGG - Intronic
908177988 1:61574845-61574867 TAGGATTGTCTTGCCAATGCAGG + Intergenic
908943063 1:69459765-69459787 TAGAAATGTCCTGCCAGTGCTGG - Intergenic
910282146 1:85513030-85513052 TAGGATTGTCTTGGCAGTGCAGG - Intronic
910384011 1:86662130-86662152 TAGGATTGTCTTGGCAGTGCAGG - Intergenic
912304018 1:108546541-108546563 TAGGACTGTCTTGGCAATGCGGG - Intergenic
915989254 1:160496650-160496672 TAGGAGTGACCAGCCAGTGTAGG - Intronic
922364487 1:224851316-224851338 AAGCACTGCCCATCCAGTGCAGG + Intergenic
922464557 1:225838356-225838378 CAGGTCTGTACAGCCACTGCTGG - Intronic
1066529245 10:36318440-36318462 TAGGATTGTCTTGGCAGTGCGGG - Intergenic
1066688568 10:38004212-38004234 CATTACTGTCCAGCTAGTGCTGG - Intergenic
1067167123 10:43874112-43874134 TAGGACTGTCCTCCCAGCACTGG - Intergenic
1067299495 10:44995923-44995945 TAGGACTGTCTTGCCAGGCCAGG + Intergenic
1069188585 10:65459770-65459792 TAGGATTGTCCTGGCAATGCGGG + Intergenic
1070256173 10:74814489-74814511 AAGGCCTGTCCTGGCAGTGCCGG + Intergenic
1070551390 10:77493400-77493422 TAGTACTGGCCAGCCAGGGCAGG + Intronic
1070888421 10:79924386-79924408 TAGGACTATCCGGGCAGGGCTGG + Intergenic
1071343120 10:84666252-84666274 TAGAGCGGACCAGCCAGTGCTGG - Intergenic
1071698061 10:87899286-87899308 TAGGATTGTCTTGGCAGTGCGGG + Intronic
1078506757 11:11956285-11956307 TAGGGCAGTCCAATCAGTGCTGG - Exonic
1082098638 11:48152888-48152910 TAGGATTGTCTTGGCAGTGCAGG + Intronic
1083999463 11:66288356-66288378 CAGGGCTGTCCAGCCAGGGAAGG - Intronic
1088440204 11:109861982-109862004 TAGGACTCACTAGCCTGTGCAGG - Intergenic
1089193270 11:116671385-116671407 TAGGACTGTCTTGGCAATGCAGG - Intergenic
1089821305 11:121229025-121229047 TTAGAATGTCCAGCAAGTGCAGG + Intergenic
1089880341 11:121767316-121767338 TAGCACAGGCCAGCCAGTTCAGG - Intergenic
1092242851 12:6846056-6846078 CATGACTGTCCAGTCAGTTCTGG + Intronic
1093182401 12:15981747-15981769 TAGGCCTGGCCAGGTAGTGCTGG - Intronic
1095393328 12:41734757-41734779 TAGGACTGTCTTGGCAATGCAGG + Intergenic
1098061289 12:66565585-66565607 TAGGACTGTCTTGGCAATGCAGG + Intronic
1099779539 12:87176092-87176114 TAGGATTGTCTTGGCAGTGCAGG - Intergenic
1101636514 12:106547373-106547395 TAGGATTGTCTTGGCAGTGCAGG + Intronic
1102466305 12:113132745-113132767 TTGGAGTGTCCAGCCAGAGGGGG - Intronic
1106141712 13:27017344-27017366 GGGGTCTGTTCAGCCAGTGCGGG + Intergenic
1107219679 13:37967517-37967539 AAAGACTGACCTGCCAGTGCTGG - Intergenic
1107487228 13:40840400-40840422 TAGGACTGTCTTGGCAATGCAGG - Intergenic
1113488531 13:110674246-110674268 TAGGATTGTCTTGGCAGTGCAGG - Intronic
1113588097 13:111479537-111479559 CAGCACGGTCCAGCCAGGGCAGG - Intergenic
1113853319 13:113430265-113430287 CAGGACTGTCCTGCCAGCCCTGG - Intronic
1119006691 14:70937595-70937617 TAGGATTGTCTTGGCAGTGCGGG + Intronic
1119196659 14:72722326-72722348 TGGGGCTGTGCAGCCTGTGCAGG - Intronic
1120478513 14:85019841-85019863 TAGGATTGTCCTGGCAATGCGGG + Intergenic
1123041017 14:105490271-105490293 TGGGCGTGTCCAGCCAGGGCTGG + Intronic
1124177452 15:27439595-27439617 TACCACTGTCCAGCCAGCCCTGG - Intronic
1130840645 15:87697534-87697556 TAGGATTGTCTTGGCAGTGCGGG - Intergenic
1132651278 16:1022443-1022465 TCGGAGTGTCCAGACAGAGCTGG + Intergenic
1137824613 16:51480714-51480736 TAGGATTGTCTTGGCAGTGCAGG + Intergenic
1139356437 16:66369573-66369595 TGGGACTGTCAGGGCAGTGCGGG - Intronic
1142501129 17:334059-334081 CAGGGCTCTCAAGCCAGTGCTGG - Intronic
1143258057 17:5577789-5577811 TAGGATTGTCTTGGCAGTGCGGG - Intronic
1144436259 17:15245412-15245434 TAGGACAGCCCAGGCAGGGCTGG + Intronic
1146285461 17:31571524-31571546 TCGGAATGTCCAGCAAGGGCGGG + Intronic
1146815202 17:35936898-35936920 TAGGGCTGTCCAGGGAGGGCTGG - Intronic
1147034801 17:37671872-37671894 AAGGGCCCTCCAGCCAGTGCAGG - Intergenic
1148732860 17:49848210-49848232 TTGGCCTGTCCAGCCAGGGAGGG - Intergenic
1149357305 17:55854429-55854451 TAGGACTGTTTAGGCATTGCTGG - Intergenic
1150384959 17:64751413-64751435 GAGGTCTGGCCAGCCAGGGCTGG + Intergenic
1150869377 17:68888795-68888817 TAGGAGTGACCAGCCAGTAGAGG + Intronic
1151538245 17:74750506-74750528 AAGCCCTGTCCAGCCAGAGCTGG + Intronic
1152780893 17:82227065-82227087 CAGGACTGTCCACCCAGAGCTGG - Intergenic
1153615668 18:6930773-6930795 TAGGACCGTCAAGCGAGGGCTGG + Intergenic
1155326452 18:24669671-24669693 TGGTGCTGTCGAGCCAGTGCAGG - Intergenic
1155422731 18:25672729-25672751 AGGGACTGTCCAGCAAGAGCTGG - Intergenic
1157176230 18:45454965-45454987 TAGGATTGTCTTGGCAGTGCAGG + Intronic
1160046244 18:75390059-75390081 AAGGACTGTCCAGGCAGGGCAGG + Intergenic
1160810265 19:1010236-1010258 TGGGACTGCCCAGCCTGTGTCGG - Exonic
1161787147 19:6333758-6333780 TGGCACTGTCCAGGCAGGGCAGG + Intergenic
1166863774 19:45824091-45824113 GAGGACAGCCCAGCCAGGGCTGG - Intronic
1168037288 19:53730130-53730152 CAGGACACTCCAGCCAGGGCAGG - Intergenic
1168413506 19:56154795-56154817 TAGGCCTGTCCACCCACTGTGGG - Intronic
927183590 2:20466614-20466636 TGGCACTGTCAAGCCAGTTCAGG - Intergenic
933609088 2:84415556-84415578 TAGGACTGTTCAGGAAGTGAGGG - Intergenic
934314900 2:91908700-91908722 TAGGACTGTCTTGGCAATGCAGG - Intergenic
934679740 2:96274890-96274912 CAGGTCTGGCCAGCCAGGGCTGG - Exonic
934705434 2:96474661-96474683 TAGGAATCTCCAGGCATTGCTGG - Intergenic
934985815 2:98883953-98883975 TAGGACGGGACAGCCAGAGCAGG - Intronic
935068628 2:99674570-99674592 TAGGACTGCCCAGCAAGCACTGG + Intronic
937402523 2:121597008-121597030 TAGGTCTGTCCAGTCTGTGTGGG - Intronic
939152810 2:138493432-138493454 TAGGCCTGTCCAGCAAGAGAGGG + Intergenic
945460492 2:210102242-210102264 TAGGACTGTCTTGGCAATGCGGG + Intronic
948679246 2:239621489-239621511 TGGGGCTGTCCAGGCAGTGATGG - Intergenic
948763701 2:240208750-240208772 TGGGTGTGTCCAGCCAGGGCAGG - Intergenic
1169355010 20:4898545-4898567 TAGGACAGTCCTGCCAGAGCAGG + Intronic
1169428611 20:5515648-5515670 TAGGACTGACTTGCCAATGCAGG + Intergenic
1169445450 20:5667537-5667559 TAGACCTGTCCAGACAGTCCAGG - Intergenic
1170244294 20:14204043-14204065 TAGGACAGTCCCTCCATTGCTGG - Intronic
1172952451 20:38730734-38730756 GAGGACCCTTCAGCCAGTGCCGG - Intergenic
1175038909 20:56027139-56027161 TATCATTGGCCAGCCAGTGCTGG - Intergenic
1175189848 20:57204060-57204082 TAGGACAGTCCAGGCAGGACTGG + Intronic
1175485069 20:59339861-59339883 TAGGCCTCTGCAGGCAGTGCCGG - Intergenic
1176915984 21:14625808-14625830 TAGGATTGTCCTGGCAATGCAGG - Intronic
1180006031 21:45021133-45021155 CCAGACTGTCCAGCCAGTCCAGG + Intergenic
1180847388 22:18991292-18991314 TAGGGCTGCTCAGCCAGTCCTGG + Intergenic
1181174696 22:21028928-21028950 GAGGACTCCCCAGCCTGTGCAGG + Exonic
1181551155 22:23639747-23639769 TGGGACTGTCCAGGGAGGGCTGG + Intergenic
1182045684 22:27272252-27272274 TAGGACTGACCAGCCTCTGAGGG - Intergenic
1182359775 22:29739738-29739760 TGGGACTGGCCAGCAAGTCCTGG - Intronic
1183862429 22:40679639-40679661 CAGGTCCATCCAGCCAGTGCCGG - Exonic
1184758514 22:46531646-46531668 CAGGACTGCACAGCCAGTGGGGG - Intronic
950446704 3:13042796-13042818 TAGGACTGTCCAGCCAGTGCCGG - Intronic
952550166 3:34467772-34467794 TAGGACTGTCTTGACAATGCAGG + Intergenic
953367066 3:42354063-42354085 CAGGGCTGTCCAGGCAGAGCTGG - Intergenic
957871714 3:86097620-86097642 TAGGATTGTCCTGGCAATGCGGG - Intergenic
958105723 3:89070106-89070128 TAGGATTGTCCTGGCAATGCAGG + Intergenic
958626084 3:96626001-96626023 TAGGATTGTCTAGGCAATGCGGG - Intergenic
958651986 3:96947928-96947950 TAGGACTGTCTTGGCAATGCAGG - Intronic
959340546 3:105124557-105124579 AAGCTCTGTCTAGCCAGTGCAGG - Intergenic
962818952 3:139028080-139028102 TAGGACTGTCTTGGCAATGCGGG + Intronic
963853299 3:150228385-150228407 CTGGGCTGTCCAGCCAGAGCCGG - Intergenic
964500639 3:157344705-157344727 TAGGACTGTCTTGGCAATGCGGG - Intronic
964817326 3:160730880-160730902 AAGGATTGACCAGCCACTGCTGG - Intergenic
967110055 3:186285102-186285124 TAGGACTGCCCTGCCACTTCTGG + Intronic
968000965 3:195206476-195206498 TAGTACTTTCCAGCCAGTTGCGG + Intronic
975429461 4:74271631-74271653 TAGGATTGTCTTGGCAGTGCGGG + Intronic
975753136 4:77545208-77545230 TAGGACTGTCTTGGCAATGCGGG + Intronic
976491984 4:85681498-85681520 TAGCACAGTGGAGCCAGTGCTGG + Intronic
976834077 4:89349972-89349994 TAGGATTGTCTTGGCAGTGCAGG + Intergenic
980414130 4:132462426-132462448 TAGGATTGTCTTGGCAGTGCAGG - Intergenic
980736915 4:136901779-136901801 AAAGACTGTCCTGCCAATGCTGG - Intergenic
980962070 4:139485035-139485057 CAGGAGTGTGCAGGCAGTGCAGG + Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
982027185 4:151262576-151262598 TAGGCCTGTCCAGACACTCCTGG - Intronic
983440570 4:167778368-167778390 TAGGACTGTCTTGGCAATGCGGG + Intergenic
984340097 4:178446268-178446290 TAGGATTGTCCTGGCAATGCAGG + Intergenic
985591815 5:769691-769713 TAGGCCTGTCCAGCCCGTCAGGG - Intergenic
985609730 5:880650-880672 TAGGCCTGTCCAGCCCGTCAGGG - Intronic
987410511 5:17610414-17610436 TAGGTCTGCACAGCCAGTGCTGG - Intergenic
988030573 5:25758284-25758306 TAGCACAGTTCAGCCAGTTCTGG - Intergenic
989517281 5:42358179-42358201 TAGGACTGTCTTGGCAATGCAGG - Intergenic
991070995 5:62480400-62480422 TAGGACTGTCTCGGCAATGCGGG + Intronic
992257162 5:74932704-74932726 TATGACTGGCAAGCTAGTGCTGG + Intergenic
992398226 5:76387016-76387038 TAGGTCTGTTAAGCCAGAGCTGG - Intergenic
992814400 5:80421756-80421778 TAGGACTGTCTCGGCAATGCGGG + Intronic
994345774 5:98684469-98684491 TAGGATTGTCTTGCCTGTGCAGG - Intergenic
995563813 5:113412233-113412255 TAGGATTGTCCTGACAATGCAGG + Intronic
996157378 5:120118651-120118673 TAGGATTGTCTTGGCAGTGCAGG - Intergenic
996229379 5:121042213-121042235 TAGGATTGTCTTGACAGTGCAGG + Intergenic
997261540 5:132469212-132469234 AAGACCTGGCCAGCCAGTGCTGG + Intronic
998531362 5:142888235-142888257 AAGGGCTGCACAGCCAGTGCTGG - Intronic
999459550 5:151746244-151746266 TAGGTTTGTTCAGCAAGTGCTGG + Intronic
999910977 5:156198824-156198846 CAGGACTTTCCAGCCAATGGTGG + Intronic
1000667048 5:164011455-164011477 TAGGTCCGTACAGCCAGTGGTGG - Intergenic
1002011509 5:176286166-176286188 TAGGACTGTCTTGGCAATGCAGG - Intronic
1003592646 6:7448614-7448636 TAGGACTGTCCCAGTAGTGCAGG + Intergenic
1005278156 6:24242344-24242366 GAGGGCTGGCCAGTCAGTGCAGG - Intronic
1007418627 6:41706386-41706408 CAGGACGGGGCAGCCAGTGCTGG + Intronic
1007615735 6:43179042-43179064 AGGGACTGGCCAGCCAGTTCAGG - Intronic
1009634625 6:66249528-66249550 TAGGATTGTCCTGGCAATGCGGG - Intergenic
1010198733 6:73264420-73264442 TAGGAGTCTCAAGCCAGTACAGG + Intronic
1010962002 6:82155919-82155941 TAGGATTGTCTAGGCAATGCGGG - Intergenic
1011540786 6:88426158-88426180 TATCACTGTCCAGCCAGAGTGGG - Intergenic
1014785003 6:125608762-125608784 TAGGATTGTCCTGGCAATGCGGG + Intergenic
1014785072 6:125609629-125609651 TAGGATTGTCCTGGCAATGCGGG - Intergenic
1017150290 6:151273201-151273223 TAAGAATGTCCAGCCTGGGCGGG - Intronic
1018458767 6:163977453-163977475 TAGGATTGTCCTGGCAATGCGGG + Intergenic
1019891892 7:3954190-3954212 CAGGACTGGGCAGCCAGTGGCGG - Intronic
1021275277 7:18642387-18642409 TATGACTCTGCAGCCACTGCTGG - Intronic
1022341060 7:29468623-29468645 GACTACTGTACAGCCAGTGCTGG - Intronic
1024249303 7:47494306-47494328 TAGCACTGCCCAGCAAGAGCTGG - Intronic
1027175240 7:75899220-75899242 CAGGGCTGACCAGCCAGGGCAGG - Intronic
1027226949 7:76249606-76249628 TGGGATTGTCCAGCCATTGCTGG + Intronic
1027727450 7:81825540-81825562 TAGGATTGTCTTGACAGTGCAGG + Intergenic
1028126297 7:87116674-87116696 TAGAACTGTGCAGCAAGTGTGGG + Intergenic
1029284726 7:99457760-99457782 GAGGTCTCTCCAGACAGTGCCGG + Intronic
1031391098 7:121216217-121216239 CAGAACTGTCCAGCCAGCCCTGG - Intronic
1031856285 7:126926828-126926850 TATGAATGTCCAACCAATGCTGG - Intronic
1031866689 7:127044659-127044681 AGGGACTGTCCAGCCAGGGATGG + Intronic
1036016069 8:4786004-4786026 TAGGAAGCTCCAGCCACTGCTGG - Intronic
1037229652 8:16641891-16641913 TGGGATTTTCCAGCCAGTGATGG - Intergenic
1037641413 8:20747320-20747342 TAGGACTGTCTTGGCAATGCGGG - Intergenic
1037696789 8:21230485-21230507 TAGGGCTGCCCAGCCTGTGCTGG - Intergenic
1039170799 8:34742716-34742738 TAGGACTGTCTTGGCAATGCAGG - Intergenic
1039672137 8:39613140-39613162 CACCACTGTCCAGCCACTGCTGG + Intronic
1039894532 8:41707131-41707153 TATCACTGCACAGCCAGTGCTGG + Intronic
1041987065 8:63934869-63934891 TAACAATGTCCAGCCATTGCTGG - Intergenic
1047225714 8:122954001-122954023 TAGGCCTGGCCAGCCTCTGCAGG - Exonic
1047517649 8:125569122-125569144 TAGAACTCTCCAGCTTGTGCTGG - Intergenic
1048475332 8:134737625-134737647 TAGGACTGCCCAGCTAGGTCAGG + Intergenic
1049635992 8:143689755-143689777 GAGGACAGGCCAGCCATTGCTGG - Intronic
1049643718 8:143726907-143726929 GAGGGCTGTCCAGCCCTTGCGGG + Exonic
1049952881 9:662356-662378 TAGGACTGTCTTGGCAATGCGGG - Intronic
1050497471 9:6259477-6259499 TAGGACTGTCTTGGCAATGCGGG + Intergenic
1050540461 9:6665051-6665073 AAGCTCTGTCCAGGCAGTGCTGG - Intergenic
1061961355 9:133990855-133990877 TAAGCCGGTCCAGGCAGTGCTGG + Intronic
1188511096 X:30937408-30937430 TGGGTGTGTCCAGCCAGAGCCGG - Intronic
1189550440 X:42087194-42087216 TAGGAATGACCAGCCCTTGCAGG - Intergenic
1190547208 X:51540919-51540941 TAGGATTGTCCTGGCAATGCAGG - Intergenic
1192611093 X:72568006-72568028 TATGACTGCCCAGCCACTGAAGG - Exonic
1193065806 X:77258300-77258322 TAGGATTGTCTTGGCAGTGCGGG - Intergenic
1195508686 X:105688752-105688774 TAGGATTGTCCTGGCAATGCAGG - Intronic
1195723147 X:107886584-107886606 TAGGATTGTCTTGGCAGTGCAGG + Intronic
1198689429 X:139264194-139264216 TAGGATTGTCTTGCCAATGCAGG - Intergenic
1198895739 X:141452590-141452612 TAGGATTGTCTTGCCAATGCGGG - Intergenic
1199939112 X:152607291-152607313 TAGGATTGTCCTGGCAATGCGGG + Intergenic
1200142130 X:153907628-153907650 CAGCCCTGTCCAGCAAGTGCAGG - Exonic
1202117346 Y:21482396-21482418 TAGGACTGTCCTTCCACAGCCGG - Intergenic
1202241458 Y:22774749-22774771 TAGGATTGGCCTGGCAGTGCGGG + Intergenic