ID: 950447103

View in Genome Browser
Species Human (GRCh38)
Location 3:13044694-13044716
Sequence ATGTCCTTCTCCAGGAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950447103_950447106 0 Left 950447103 3:13044694-13044716 CCCACACTCCTGGAGAAGGACAT 0: 1
1: 1
2: 2
3: 19
4: 191
Right 950447106 3:13044717-13044739 TAGCTTCCCTCTCACGCCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 167
950447103_950447112 29 Left 950447103 3:13044694-13044716 CCCACACTCCTGGAGAAGGACAT 0: 1
1: 1
2: 2
3: 19
4: 191
Right 950447112 3:13044746-13044768 AAGCCGGCTGTGCCTTTGAAAGG 0: 1
1: 0
2: 0
3: 9
4: 103
950447103_950447110 13 Left 950447103 3:13044694-13044716 CCCACACTCCTGGAGAAGGACAT 0: 1
1: 1
2: 2
3: 19
4: 191
Right 950447110 3:13044730-13044752 ACGCCTGTGGCAGAGGAAGCCGG 0: 1
1: 0
2: 0
3: 25
4: 238
950447103_950447108 6 Left 950447103 3:13044694-13044716 CCCACACTCCTGGAGAAGGACAT 0: 1
1: 1
2: 2
3: 19
4: 191
Right 950447108 3:13044723-13044745 CCCTCTCACGCCTGTGGCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950447103 Original CRISPR ATGTCCTTCTCCAGGAGTGT GGG (reversed) Intronic
901330595 1:8404873-8404895 TTGTCATTCTCAAGGAGGGTGGG - Intronic
902092704 1:13916122-13916144 ATGTGGTTTTCCAGGAGTGAGGG + Intergenic
904317333 1:29673946-29673968 ATGTGCTTCTCCAGGTGTGTGGG + Intergenic
908643691 1:66253560-66253582 ATTGCCTTCTCCAGGGGTTTGGG + Intronic
908802847 1:67897963-67897985 CTGTCCTTATCCTGGGGTGTGGG + Intergenic
909300746 1:74010297-74010319 ATGCGCTTTTCCAGGAGTGCTGG + Intergenic
912928146 1:113930694-113930716 AGTTCCGTCTCCAGGAGCGTTGG + Intronic
915229426 1:154434634-154434656 ATGTGCGTCGCCAGTAGTGTCGG + Exonic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
918110775 1:181453631-181453653 ATATCCTGCTCCAGAAGTGTAGG + Intronic
918429894 1:184448650-184448672 TTTTCCTTCTCTAGGTGTGTAGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
921001292 1:211046411-211046433 ATGCCCTTCCCCAGGAGCGAGGG + Intronic
922864087 1:228843797-228843819 ATGTCCTCCTCCAAAAGTGCTGG - Intergenic
1062815203 10:494272-494294 ATGTCCTCCTCCTGGGGTTTAGG - Intronic
1063240822 10:4167563-4167585 CTGTTCATCTCCAGGAGTCTGGG - Intergenic
1063593686 10:7413328-7413350 ATTTCCTTCTGCAGGAGTCGTGG + Intergenic
1064739265 10:18415532-18415554 ACTGCCTTCTCCAGCAGTGTTGG - Intronic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1065878065 10:30014102-30014124 AGGTCCTTCTCCAGGAGTGTGGG - Exonic
1068304150 10:55181975-55181997 TTGTCCTTCTTCAGAAGTTTTGG + Intronic
1069535971 10:69253370-69253392 ATGTCCTTCTGCAGGGGCTTGGG + Intronic
1070174063 10:73955558-73955580 ATATTCTTGTCCAGGAGTGATGG - Intergenic
1070279308 10:75037250-75037272 ATGTGCTCCTCCAGCAGGGTGGG - Intergenic
1076751009 10:132543056-132543078 ATCTCTGTCTCCCGGAGTGTTGG + Intronic
1077060115 11:614208-614230 TTGTCCCTCTCCAGGAGCCTTGG + Exonic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079460860 11:20676678-20676700 ATTTCCTTCTCCAAGGCTGTAGG + Intronic
1080773165 11:35361494-35361516 AAGGCCTTCTCCAGAAGTGAGGG - Intronic
1080997498 11:37621736-37621758 ATGTTCTGCTTCAGGAGTTTGGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082748683 11:56995533-56995555 ATGACCTTCCCCTGGAGTTTTGG + Intergenic
1083331469 11:61900367-61900389 ATGTCCCTCCCCAGGAGTGTTGG - Intronic
1085769666 11:79313630-79313652 ATGCTCTTCTCCAAGTGTGTTGG + Intronic
1086289444 11:85290800-85290822 ATCTCATTTTCAAGGAGTGTAGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088479730 11:110284379-110284401 ATGGACTTCTCCAGGGTTGTGGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090997044 11:131876213-131876235 GTGTGCTTCTCCAGCTGTGTGGG + Intronic
1091247991 11:134116102-134116124 ATTTCCATCTCCTTGAGTGTGGG - Intronic
1093083623 12:14842032-14842054 ATGTCCTTTTCCAGGAGGGGAGG - Intronic
1094195076 12:27740683-27740705 ATATCCTTCTACTGGAGTCTAGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097670689 12:62533915-62533937 ATTCCCTTCTCCAACAGTGTTGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1103072772 12:117958338-117958360 TTGCCCTTCACCAGCAGTGTTGG - Intronic
1103821105 12:123699498-123699520 ATGTTCTCCCCCAGGTGTGTGGG + Intronic
1106057569 13:26253255-26253277 ATGTCCTGCTTCAGGAGTCCTGG - Intergenic
1106593509 13:31118031-31118053 ATGTCCTTCTGCAGGATTCAGGG + Intergenic
1108027597 13:46194695-46194717 ATGCCTTACTCCAGGATTGTTGG - Intronic
1111915545 13:94356628-94356650 ACTTCCTTCACCAGGAGTGATGG - Intronic
1112066612 13:95799835-95799857 ATGGCCTTCTCCAGTATTCTAGG - Intergenic
1112484104 13:99804231-99804253 AAGTCCTGCTGCAGGAGTTTGGG + Intronic
1112579718 13:100668105-100668127 TTGTCCTTCTCCGAGACTGTCGG - Intronic
1113294058 13:108938576-108938598 ACCTCCTACTCCAGGAGAGTGGG + Intronic
1113500211 13:110767425-110767447 ATGTCCTTCTCCATTTGTGATGG - Intergenic
1113717419 13:112521832-112521854 ATGTCCTTCTCCACAAGTTCTGG - Intronic
1115632859 14:35262762-35262784 ATGTCGTTATCCAGGAGAATGGG + Intronic
1115693281 14:35868943-35868965 CTTTCATTCTCCAGTAGTGTAGG + Intronic
1118781815 14:69013692-69013714 AGGTCCTTATGCAGGAGTCTCGG + Intergenic
1121054053 14:90838652-90838674 ATGTCCCTGTCCTGGAGTTTGGG + Intergenic
1127776015 15:62264869-62264891 GTTTTCTACTCCAGGAGTGTAGG - Intergenic
1128909879 15:71503749-71503771 ATGTCACTCTCCAGGGTTGTTGG + Intronic
1131103544 15:89713758-89713780 ATATCCTTCGCCAGGCGTGGTGG - Intronic
1131286772 15:91065885-91065907 CTGTCCTTCCCCAGGACTCTTGG - Intergenic
1133592258 16:7257023-7257045 ATCCCATTCTCCAGGAGGGTCGG - Intronic
1133640742 16:7714935-7714957 CTGTCCTCCCCCTGGAGTGTGGG + Intergenic
1133876726 16:9741772-9741794 AATTCCTTCTCCTTGAGTGTGGG + Intergenic
1135756563 16:25103612-25103634 ATGACCTTCTCCAGGAGTCGAGG - Intergenic
1137949609 16:52771226-52771248 AGGCCCTGCTCCAGGAGTTTTGG + Intergenic
1139549093 16:67663620-67663642 GTGTCCTTCACCCTGAGTGTCGG + Intronic
1143708920 17:8720036-8720058 ATCTGCTTGTCCAGGAGTGAGGG + Intergenic
1144287646 17:13793706-13793728 ATGTACTTCTCCAGGAGCACTGG - Intergenic
1144637178 17:16917622-16917644 ATGTCATTCTTAAGGAGAGTTGG + Intergenic
1147443621 17:40462079-40462101 ATGTCCTCCCCCAGGAGAGGAGG + Intergenic
1148126624 17:45240798-45240820 GTGTCTTTCTCAATGAGTGTGGG + Intronic
1148729260 17:49821501-49821523 ATGTCCTTCACAAGGTGTGATGG - Intronic
1151687194 17:75655038-75655060 ATGTCATTCTCCCGAAGTGTTGG + Intronic
1152615212 17:81334665-81334687 CTGACCTTCCCCAGGAGTTTGGG + Intergenic
1155313565 18:24548692-24548714 ATGTCCTTCTCCAATATAGTGGG - Intergenic
1155837139 18:30600151-30600173 ATGCCCTCCTCCAGGAGTTTGGG + Intergenic
1156605396 18:38660428-38660450 ATATCTTTCTCCTAGAGTGTAGG + Intergenic
1157340169 18:46771286-46771308 ATGGCTTTTTCTAGGAGTGTGGG - Intergenic
1157450812 18:47787137-47787159 ATTTCCCTCTCCTTGAGTGTGGG + Intergenic
1158649789 18:59274316-59274338 ATCTCCTTGGCCCGGAGTGTTGG - Intergenic
1159048290 18:63391908-63391930 ATATCCTTTTACAGGAGTCTAGG - Intronic
1159052170 18:63430974-63430996 ATTTCCTTCTCCTTGAGTGCAGG - Intergenic
1161717320 19:5883678-5883700 ATGTCCTTCAGCAGGAGAATGGG + Intronic
1164792802 19:31002492-31002514 CTGCCCTTTTCCAGGAGAGTGGG + Intergenic
1164961653 19:32436168-32436190 AGGTCCTTCTCTAGAAATGTGGG - Intronic
1166043186 19:40215212-40215234 ATGTCCATGTCCAGCAGTGTGGG - Exonic
1168065003 19:53914347-53914369 CTGTACTACTCCAGGGGTGTTGG - Intronic
925328492 2:3040618-3040640 CTGTCATTCTCCAGCAGTGCAGG - Intergenic
925351126 2:3201269-3201291 ACCTCCTTCTCCAGGAATTTGGG - Intronic
926674139 2:15605366-15605388 ACTTCCTTCACCAGGACTGTAGG - Intronic
927228615 2:20797094-20797116 ATGTACTTTTCCAGTAGTGAAGG - Intronic
928815284 2:35287118-35287140 ATGTCTTTGTCAAGGAGTCTTGG + Intergenic
930104602 2:47630130-47630152 AAGTGCTTGTCCAGGAGAGTCGG - Intergenic
933021774 2:77203322-77203344 CTGTCCATCTCCAGGAGTCAAGG - Intronic
933769030 2:85731358-85731380 ATGTCCTTATCCTGCAGTGTTGG + Intergenic
936121212 2:109746910-109746932 TTGTCTTTCTCCATGAGTGGAGG + Intergenic
936223484 2:110624561-110624583 TTGTCTTTCTCCATGAGTGGAGG - Intergenic
937744373 2:125393856-125393878 ATGTACTTGTCCAGGAGCGGTGG - Intergenic
938196839 2:129335897-129335919 ATGTCCTGCCCCTGGAGAGTGGG - Intergenic
942185699 2:173422900-173422922 ATGTCCTTGTCCAGTATTGTTGG + Intergenic
942324306 2:174762551-174762573 ATGTCAATCTCCATGAGGGTAGG - Intronic
942570354 2:177307933-177307955 ATATCCTTCTCCAGGGGAGAAGG + Intronic
942694467 2:178624765-178624787 CTTTCCTTCTCCAAGAGTTTTGG + Intronic
943065587 2:183082709-183082731 ATGTTCTTGGCCAGGAGTGGTGG - Intronic
945000524 2:205345455-205345477 ATGTCCTGCTTAAGGAGGGTGGG + Intronic
946372755 2:219290603-219290625 ACCTCCATCTCCAGGAGTGAAGG - Exonic
947883952 2:233547912-233547934 CTGTCATTCTTCAGGAGTGTGGG - Intronic
1168952467 20:1811746-1811768 ATGTCATCCACCAGGAGTGCTGG - Intergenic
1169865881 20:10199457-10199479 CTCTCCTTCTCTAGGGGTGTGGG + Intergenic
1169905304 20:10597094-10597116 GGGTCTTTCTACAGGAGTGTCGG + Intronic
1170445814 20:16426304-16426326 ATGTCCCTCTACATAAGTGTAGG - Intronic
1175364501 20:58443001-58443023 ATGTCCCTCTTCAGGGATGTGGG + Intronic
1175520409 20:59599167-59599189 CTGCCCTGCTCCAGGAGTGAAGG - Intronic
1175757363 20:61538286-61538308 GTGTCCTTCTCCCAGAGTGACGG - Intronic
1179466320 21:41576557-41576579 AATTCCTTCCCCATGAGTGTGGG - Intergenic
1184302175 22:43568062-43568084 ATGAGCTTCTTCAGGAGTGGGGG - Intronic
1184309884 22:43634303-43634325 ATGCCATTTTTCAGGAGTGTGGG + Intronic
949184422 3:1172965-1172987 AGATCTTTCTCCAGGAGTGGAGG + Intronic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
950447103 3:13044694-13044716 ATGTCCTTCTCCAGGAGTGTGGG - Intronic
950608821 3:14111320-14111342 GTGTCCCTCTCCTTGAGTGTGGG + Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952584227 3:34871996-34872018 CTTTCCTTCTACAGGAGAGTGGG - Intergenic
955689763 3:61579357-61579379 ATCTCCTTCACCAGGGGTGAGGG + Intronic
957908975 3:86597028-86597050 ATCTCCTTTTTCAGAAGTGTTGG - Intergenic
959565001 3:107825209-107825231 ATGTCTTTCTCCAGAAGTGGAGG - Intergenic
959921623 3:111874517-111874539 ATGTCCTCATTCAGGAGTGGGGG + Intronic
961734476 3:128992973-128992995 ATGACTTTCTGCAGGAGTTTAGG - Intronic
962923239 3:139969725-139969747 AGGTCCTCCTCCAAGAGTGGTGG - Intronic
965002577 3:162974153-162974175 ATGTTCTACACAAGGAGTGTTGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968920429 4:3519466-3519488 ATGTCCTTGGCCAGGAGAGATGG - Intronic
969501142 4:7553973-7553995 ATGTTCTTTTCCAGCAATGTGGG - Intronic
971536299 4:27755574-27755596 ATTTCCTTCTCCATGAAGGTGGG - Intergenic
971614095 4:28764793-28764815 AACTCCTTATCCAGGAGAGTGGG - Intergenic
972754591 4:42032506-42032528 ATTTCCTTCTCCAGATGAGTTGG + Intronic
973813874 4:54600250-54600272 ATATCCTTCTACAGGACTGAAGG + Intergenic
976660313 4:87533980-87534002 ATGTCTTTATTCTGGAGTGTAGG + Intergenic
977149165 4:93487743-93487765 ATTTTCTTCTCCAGGACTCTGGG + Intronic
977247438 4:94649366-94649388 AAGACCCTCTCCATGAGTGTGGG - Intronic
978986463 4:115019557-115019579 ATGACATTCTCCAGGAGGCTAGG - Intronic
979650561 4:123125415-123125437 ATGTCCTTCTCTGACAGTGTAGG - Intronic
981205968 4:142040847-142040869 TTGTCATTCTCCTGGAGTCTGGG + Intronic
983079303 4:163365596-163365618 ATGACTTTCTGCAGGAGAGTTGG + Intergenic
983089167 4:163484026-163484048 AGGTCCTACTACAGAAGTGTAGG - Intergenic
984575565 4:181444133-181444155 ATGTCATTCTCTCAGAGTGTGGG - Intergenic
986001059 5:3631175-3631197 AGGCCCATCTCCAGGAGTGAAGG - Intergenic
986722929 5:10572829-10572851 ATGTCCCTTGCCAGAAGTGTGGG + Intronic
986871782 5:12056659-12056681 AAGTCCTTCTGAAGGTGTGTGGG + Intergenic
987491336 5:18583726-18583748 ATGTCCTCCTTCAACAGTGTTGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
998911369 5:146964010-146964032 TTGACCTTCTCCAGGCATGTAGG + Intronic
999141516 5:149365574-149365596 ATCTCCTTCTCCAACAGTGTCGG - Intronic
1000944562 5:167404678-167404700 ATGACCCTCTCCATGCGTGTTGG + Intronic
1002536801 5:179880258-179880280 TGGCCCTTCTGCAGGAGTGTTGG + Intronic
1002573416 5:180157265-180157287 ATGTCCTTCTGCAGGTGAGTGGG + Intronic
1003063835 6:2884911-2884933 ATATTTTTCTTCAGGAGTGTAGG - Intergenic
1005044766 6:21631273-21631295 ATGTCCTTCTCAAGAAAGGTTGG - Intergenic
1005138975 6:22604805-22604827 ATATGATTCTCCAGGACTGTAGG + Intergenic
1005199324 6:23325474-23325496 ATGCCCTGCCCCATGAGTGTGGG + Intergenic
1005922488 6:30414997-30415019 GAGGCCTTCTCCAGGAGAGTTGG + Intergenic
1006024743 6:31139627-31139649 ATGTCCTTCTTCAGGCATGCAGG + Exonic
1007804251 6:44427194-44427216 ATGTCCTTATCCAAAAGAGTAGG - Intronic
1012381476 6:98624571-98624593 ATGTCCTTCTTTTTGAGTGTGGG - Intergenic
1013220323 6:108072344-108072366 ATGTCCTTGGCCAGGTGTGGTGG + Intronic
1015627209 6:135191915-135191937 ATGTCCCTCTCGTGGTGTGTAGG + Intronic
1018127714 6:160697641-160697663 ATCTCCGTCTCCAGAAGTGCTGG - Intergenic
1019455049 7:1122637-1122659 ATGTCCTTCGGGAGGACTGTGGG - Intronic
1020921400 7:14269314-14269336 ATTTCCCTCTCCTGGAGTGTGGG - Intronic
1023464446 7:40438419-40438441 ATCTCCCTCTCCAGGAGAGGAGG + Intronic
1023823755 7:43995051-43995073 AGGCCCCTCTCCAGGACTGTGGG - Intergenic
1026299351 7:69083637-69083659 ACCTTCTTCTCCAGGTGTGTGGG + Intergenic
1026553663 7:71388350-71388372 ATTTCCTTCAGCAGGTGTGTGGG - Exonic
1029218137 7:98967044-98967066 ATGGACTTCTCCCGGAGTGTAGG - Exonic
1029752022 7:102548464-102548486 AGGCCCCTCTCCAGGACTGTGGG - Intronic
1029769974 7:102647558-102647580 AGGCCCCTCTCCAGGACTGTGGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1033024421 7:137758762-137758784 ATGTCCTTCCCCAACAGTGCTGG + Intronic
1034574805 7:151987757-151987779 CTGTCCTCCTCCACGTGTGTCGG - Intronic
1039092263 8:33844712-33844734 GTGTCCTTACCCTGGAGTGTGGG - Intergenic
1040626618 8:49157209-49157231 CTGTCCATATCCAGGAGTGTTGG + Intergenic
1040785127 8:51156679-51156701 AAGTCTTTCACCAGGACTGTAGG + Intergenic
1042631309 8:70820102-70820124 ATGACCTGCTTCAGGAGTGAAGG - Intergenic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1046743245 8:117850435-117850457 ATATCCCTCTCCACAAGTGTTGG + Intronic
1047330796 8:123885007-123885029 ATGGCCTTCTCCAGATCTGTTGG - Intronic
1049832567 8:144711431-144711453 ATGTCCACTTCCTGGAGTGTAGG - Intergenic
1049931796 9:464252-464274 AAGTCCTTCTCCAGGGTTGCAGG - Exonic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052037469 9:23699056-23699078 ATGTCTTTCTATAGGAGTGAAGG + Intronic
1052242912 9:26296520-26296542 AGGTCCTTCATCAGGAGTCTGGG + Intergenic
1053053403 9:34979328-34979350 ATGTCCTTCCCCAGCAGGCTAGG + Exonic
1054977574 9:71165855-71165877 ATGTCTATCCCCAGGAATGTGGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057037060 9:91818741-91818763 ATTTCCATCTCCAGGACTGCTGG - Intronic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1059959995 9:119555757-119555779 AGGTCCTTAACCAGGAGTGGTGG - Intergenic
1060281778 9:122219938-122219960 ACCGCCTTCTCCAGGAGCGTGGG - Intronic
1061761711 9:132856165-132856187 ATGTCCTTTTTCAGAAATGTGGG - Intronic
1187085962 X:16044191-16044213 ATGTCATTCTCCTGGTGTGTTGG - Intergenic
1187086944 X:16050755-16050777 ATGTCATTCTCCTGGTGTGTTGG - Intergenic
1187636247 X:21231822-21231844 ATGACTTTCTTCAGGGGTGTTGG - Intergenic
1187960182 X:24560530-24560552 CTTTCCTTCTCCAGGACTCTGGG - Intronic
1190712984 X:53082725-53082747 ATGTCATTCTCGAGGAGGGGGGG + Exonic
1190934069 X:54978586-54978608 ATTTCCTTCCCCTTGAGTGTGGG + Intronic
1191774105 X:64793620-64793642 AAGTCCTAATCCAGGAGAGTGGG - Intergenic
1193978473 X:88152365-88152387 ATTCCCTTCTCCATGAGTGTGGG - Intergenic
1199540337 X:148951819-148951841 GTGTCTTTCTCCAGCAGTGGGGG - Intronic