ID: 950447559

View in Genome Browser
Species Human (GRCh38)
Location 3:13047127-13047149
Sequence CCCAAGGACCAGCCTGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 6, 3: 63, 4: 332}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950447559_950447562 -6 Left 950447559 3:13047127-13047149 CCGGCTGCAGGCTGGTCCTTGGG 0: 1
1: 0
2: 6
3: 63
4: 332
Right 950447562 3:13047144-13047166 CTTGGGAGACCCACCAGCCTTGG 0: 1
1: 1
2: 9
3: 247
4: 3222
950447559_950447563 1 Left 950447559 3:13047127-13047149 CCGGCTGCAGGCTGGTCCTTGGG 0: 1
1: 0
2: 6
3: 63
4: 332
Right 950447563 3:13047151-13047173 GACCCACCAGCCTTGGATCTCGG 0: 1
1: 0
2: 0
3: 16
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950447559 Original CRISPR CCCAAGGACCAGCCTGCAGC CGG (reversed) Intronic
900713352 1:4128863-4128885 CCCAAAGGACAGCGTGCAGCAGG - Intergenic
900735601 1:4297721-4297743 GCCAGGGGCCAGGCTGCAGCGGG + Intergenic
901012523 1:6209696-6209718 CCCCACCACCAGCCTGCGGCAGG - Intronic
901183266 1:7356252-7356274 CCCCAGGAACTGCCTGCAGAGGG - Intronic
901651657 1:10746640-10746662 ACCAAGGGCCAGCCTGGACCCGG + Intronic
902371357 1:16009114-16009136 CCCAAGGACAAGGCTGCAGAGGG + Intergenic
902672970 1:17987824-17987846 CCCTTGAACCAGCCTGCAACTGG + Intergenic
903070889 1:20726601-20726623 CAGCAGGACGAGCCTGCAGCAGG + Intronic
903677099 1:25071289-25071311 CCCAAGGGCAGGCCTGGAGCTGG + Intergenic
903709945 1:25316102-25316124 CCCAGGGTTCAGCCTGCACCTGG - Intronic
904425594 1:30420745-30420767 CCCAAGGACCAGTCTGGAGCTGG + Intergenic
905646111 1:39626119-39626141 CCCAAGGAACAGCCTGCCTTGGG + Exonic
906183510 1:43841348-43841370 CCCAAGCAAAAGCCTGCTGCAGG - Intronic
907078848 1:51602804-51602826 CACAAGGACTAGCATGCAGTGGG + Intronic
907581267 1:55574778-55574800 GCCAGGGCCCAGCCTGCAGCAGG + Intergenic
909502824 1:76354236-76354258 CACAGGGCCCAGCCTGGAGCTGG - Intronic
909948299 1:81688969-81688991 CCCCAGTACCAGCGTGGAGCTGG - Intronic
912170989 1:107098830-107098852 TCCAAGGCCCAGGCTGCATCTGG - Intergenic
913069275 1:115284776-115284798 TCCAGGGTTCAGCCTGCAGCAGG - Intergenic
913187283 1:116380425-116380447 CCCAAACACCAGCCTCCAACAGG - Intronic
913575919 1:120174828-120174850 CTCTAGGACCATCCTGCAGAAGG - Intronic
914402961 1:147341035-147341057 CCCAAGGGCAAGAGTGCAGCTGG - Intergenic
914457444 1:147849222-147849244 CTAAATGATCAGCCTGCAGCTGG + Intergenic
914558232 1:148790399-148790421 CTCTAGGACCATCCTGCAGAAGG - Intergenic
914614602 1:149339831-149339853 CTCTAGGACCATCCTGCAGAAGG + Intergenic
914918348 1:151831694-151831716 CCCATGGCCCTGCCTGCAGGTGG - Intronic
915722473 1:157994594-157994616 CCAAGGGTCCAGACTGCAGCAGG + Intronic
916188511 1:162156562-162156584 CCCAAGGACAGGCCAGCTGCAGG - Intronic
917461640 1:175235256-175235278 CCCCAGTACCAGCCTGGAGCTGG + Intergenic
918162032 1:181910448-181910470 CCAAAGGACTAGCATGCAGCTGG - Intergenic
919989503 1:202699368-202699390 CACAAACACCAGCCTGCGGCAGG + Intronic
920865057 1:209744879-209744901 CTCAAGGACCACCCTCCAGTGGG + Intergenic
922673326 1:227531997-227532019 CCCCAGTACCAGCCTGAAGCCGG - Intergenic
923082169 1:230668385-230668407 CACAGGGACCAGACAGCAGCAGG - Intronic
923808589 1:237288111-237288133 CCCCAGTACCAGCCTGGATCTGG - Intronic
1062946718 10:1466986-1467008 CTGAAGGACCGGCCTTCAGCAGG + Intronic
1063140200 10:3249877-3249899 TCCAAGGGCCAGTCTGCACCAGG + Intergenic
1063380938 10:5585360-5585382 CCCACGGACCAGCCAGCAGAGGG - Intergenic
1064029995 10:11877542-11877564 CCAAAGGACCTGCCTGGAGCTGG - Intergenic
1065971311 10:30808140-30808162 CATAATGACCAGCCTGCATCAGG + Intergenic
1066063677 10:31746324-31746346 CCCAAAGACCAGTCAGGAGCAGG + Intergenic
1067017450 10:42768777-42768799 AGAAAGGACCAACCTGCAGCTGG - Intergenic
1067083448 10:43226117-43226139 GCCAGGGCCCAGCCAGCAGCAGG + Intronic
1067093946 10:43286153-43286175 CTCAGGGAGCATCCTGCAGCTGG + Intergenic
1067147416 10:43703432-43703454 CCCGAGGCCCAGGCAGCAGCTGG + Intergenic
1067431379 10:46248213-46248235 CCCCAGGCCCAGCCAGTAGCAGG + Intergenic
1067793652 10:49305654-49305676 CCCATGGACCTGCCACCAGCGGG + Intronic
1067847645 10:49736503-49736525 CTCAGGGACCAGCTTCCAGCGGG - Exonic
1068632439 10:59311702-59311724 CCCTGGGAGCAGCCCGCAGCCGG + Intronic
1069129517 10:64681735-64681757 CCCCAGTACCAGCCTGGAGCTGG - Intergenic
1069143868 10:64863915-64863937 CCCAAGGGCCAGGGTGCAGATGG + Intergenic
1072548302 10:96457371-96457393 CCCATGGTCCAGACTTCAGCAGG + Intronic
1072810521 10:98457872-98457894 CCCGAGGACCAGGCTGCACCAGG - Intronic
1074092887 10:110279227-110279249 CACTAGGACCAGACTGCACCCGG + Exonic
1075080793 10:119382181-119382203 CCCAAGGCAGAGCCTGCAGAGGG - Intronic
1075982687 10:126755183-126755205 CCCCAGTACCAGCCCGGAGCCGG - Intergenic
1076364874 10:129915269-129915291 CCCAGGGCCCAGCCCGGAGCAGG + Intronic
1076470707 10:130716289-130716311 CCAAAGGGCCTGCCAGCAGCTGG + Intergenic
1076731971 10:132443845-132443867 CCCAGCGCCCAGCCAGCAGCTGG + Intergenic
1076841850 10:133049748-133049770 CTCAAGGAGAAACCTGCAGCAGG - Intergenic
1076889444 10:133276638-133276660 CCCAGGGACCAGCCCGAAGCCGG + Intronic
1077462347 11:2716903-2716925 CCCAAGGCCAGGCCTGCAGTAGG + Intronic
1077466940 11:2737974-2737996 CCCAGGGCCCTGCCTGGAGCAGG - Intronic
1077545847 11:3169478-3169500 CCCAGTGGCCAGCCTGGAGCTGG - Intergenic
1077548725 11:3189556-3189578 CCTGGGGACCAGCCAGCAGCTGG - Intergenic
1077722873 11:4645321-4645343 CCCCATTACCTGCCTGCAGCAGG + Intronic
1078196288 11:9139646-9139668 TCCCAGCACCAGCCAGCAGCAGG - Exonic
1079973015 11:27059405-27059427 CCCAAGCAGAAGCCTGCTGCAGG + Intronic
1080283834 11:30586196-30586218 CCCCAGCCCCAGCCTGCGGCGGG - Intronic
1080324190 11:31050694-31050716 CCCTAGTACCAGCCTGGAGCCGG + Intronic
1081153771 11:39664187-39664209 TCCTATGCCCAGCCTGCAGCGGG - Intergenic
1081614874 11:44584893-44584915 GCCAAGAACCAGCTTGCAGGTGG + Intronic
1082619345 11:55400856-55400878 CCCAAAGAGAAGCCTGCTGCAGG - Intergenic
1084323288 11:68385304-68385326 CCCAGGGCCAAGCCTGCTGCTGG - Intronic
1084553401 11:69862436-69862458 CCAAAGGCCCTGGCTGCAGCCGG - Intergenic
1085269153 11:75259967-75259989 TACAAGGACCAGGCTGGAGCTGG + Intergenic
1085417585 11:76329704-76329726 CCCAATGCCCAGCATACAGCAGG + Intergenic
1085643430 11:78207697-78207719 CCCCAGGACCTGCCTGCATCTGG + Intronic
1085747884 11:79130077-79130099 TCCCAGTACCAGCCTGGAGCTGG + Intronic
1086400887 11:86460216-86460238 ACCAAGGACCAGCCTGGGCCTGG + Intronic
1087468916 11:98546352-98546374 CCCCAGTACCAGCCTGGAGCTGG + Intergenic
1089177807 11:116561061-116561083 CCAAGGGACCAGCCTGGAGAAGG + Intergenic
1096502516 12:52073565-52073587 CCCAAGGGCCACCCTGCAAAAGG - Exonic
1096551179 12:52372797-52372819 GCCAGGGATCTGCCTGCAGCTGG + Intergenic
1096785786 12:54016602-54016624 CCCACGGGCCAGGCTGCTGCAGG - Intronic
1097156045 12:57013135-57013157 TCCAAGGACCAGCCAGCAGAGGG + Intronic
1097295558 12:57958576-57958598 CCCCAGTACCAGCATGGAGCTGG + Intergenic
1098914593 12:76244059-76244081 CCCAACATCCAGGCTGCAGCTGG - Intergenic
1098960863 12:76738795-76738817 CCCCAGTACCAGCCTGTGGCTGG - Intergenic
1099777357 12:87150973-87150995 CCCCAGTACCAGCCTGGAGCTGG - Intergenic
1104059520 12:125255614-125255636 TCCAAGGACCAGGCTCAAGCAGG - Intronic
1104353892 12:128068237-128068259 CCCTAGCACCTGCCTGCAGAGGG - Intergenic
1104605712 12:130185908-130185930 CCCAAGCTCCAGCCAGCTGCCGG - Intergenic
1104831203 12:131753067-131753089 CTCATGGACCAGCCTGTGGCCGG + Intronic
1106462893 13:29988901-29988923 CCCAAGGAGCAGGCTGCATCTGG - Intergenic
1106472762 13:30072274-30072296 GCCAAGGACAACTCTGCAGCAGG + Intergenic
1106479159 13:30123872-30123894 CCCCAGGACCAGGCTGAAGGGGG - Intergenic
1108323104 13:49305578-49305600 CCCACGGCCCTCCCTGCAGCGGG + Intergenic
1108469722 13:50756013-50756035 CCCCAGTACCAGCCTGGAGGTGG - Intronic
1109213514 13:59562677-59562699 CCCTAGTACCGGCCTGGAGCTGG - Intergenic
1110187616 13:72693333-72693355 CCCAAGCAGAAGCCTGCTGCAGG + Intergenic
1110204464 13:72896142-72896164 CCCCAGTACCAGCCTGGAGCTGG + Intronic
1110375910 13:74793899-74793921 CCCCAGTACCAGCCTAGAGCAGG - Intergenic
1110661145 13:78060596-78060618 CCCCAGTACCAGCCTGGAGCTGG - Intergenic
1111752717 13:92355418-92355440 CCCAACCACCAGCCTGGAGAGGG + Intronic
1112035292 13:95491965-95491987 CTCCAGTACCAGCCTGGAGCTGG - Intronic
1113269877 13:108662084-108662106 CCCCAGTACCAGCCTGGAGCTGG - Intronic
1113330278 13:109319791-109319813 CCCCAGTACCAGCCCGGAGCAGG + Intergenic
1113787674 13:113011098-113011120 CCCAGGGCCCCGCCTGCAGAAGG + Intronic
1115299316 14:31865987-31866009 CCCCAGTACCAGCCTGGAGCTGG + Intergenic
1115393151 14:32876971-32876993 CCCCAGTACCAGCCTGGAACTGG - Intergenic
1115527173 14:34293041-34293063 CCCCAGTACCAGCTTGGAGCTGG - Intronic
1117510726 14:56448439-56448461 CCCCAGTACCAGCCTGGAGCTGG - Intergenic
1118532048 14:66717805-66717827 CCCTAGTACAAGCCTGGAGCCGG - Intronic
1120545714 14:85808978-85809000 CCCCAGTACCAGCCTGGAGATGG - Intergenic
1121308182 14:92920522-92920544 CCCCAGGAGCAGCCCTCAGCCGG - Intergenic
1121416557 14:93783348-93783370 CCCAAGGCCCAGCATTCAGTTGG + Intronic
1121516537 14:94556032-94556054 CCCCCGTACCAGCCTGGAGCCGG - Intergenic
1121938578 14:98044763-98044785 CCCAAAGGCCAGTCTGCAGGTGG - Intergenic
1122819260 14:104333057-104333079 CGCATGGGCGAGCCTGCAGCTGG - Intergenic
1125552230 15:40553999-40554021 GCCGAGGACGAGCCAGCAGCCGG - Exonic
1125752163 15:42036543-42036565 CCCCAGGTCCACCCTGCATCTGG + Intronic
1126364151 15:47876614-47876636 CCCAAGGAACAGCCTGAGACAGG - Intergenic
1126472453 15:49028487-49028509 AGCAACAACCAGCCTGCAGCAGG - Exonic
1126473814 15:49046094-49046116 CCCAAGTCCCAGGCAGCAGCTGG + Intronic
1126513045 15:49502092-49502114 CCCAAGCAGAAGCCTGCTGCAGG + Intronic
1128094314 15:64942395-64942417 CCCCAGCACCAGCCTGCAGCTGG + Intronic
1128300704 15:66564827-66564849 CCCCAGGAGAAGCCTGCAGGGGG + Exonic
1128424115 15:67521802-67521824 CCCGAGGACGCGCCCGCAGCAGG - Intronic
1129043875 15:72715461-72715483 TCCTAGGTCCAGCCTGCTGCTGG + Intronic
1129097537 15:73225103-73225125 CCCCAGTACCAGCCTGGAGCTGG - Intronic
1129293432 15:74585967-74585989 ACCAAGGGCCAGCCTGCACTGGG + Intronic
1129946202 15:79541248-79541270 CCCCAGGTCCAGCTTACAGCAGG + Intergenic
1130298386 15:82662988-82663010 CCCTAGGGCCATCCAGCAGCTGG + Intronic
1131091485 15:89627810-89627832 CCGCTGGACCAGCCTGCTGCGGG + Exonic
1131515901 15:93076466-93076488 CCCAAGGTCTAGCCTGCAGCAGG - Intronic
1132458323 16:36475-36497 TCCAAGGTCCAGCCTGCAAGGGG + Intergenic
1133771194 16:8868193-8868215 CCCAAGGCCCTGCCTGGAGCGGG + Exonic
1134227157 16:12399988-12400010 CCCGGACACCAGCCTGCAGCAGG - Intronic
1134507428 16:14819599-14819621 ACCAATGAACAGGCTGCAGCAGG - Intronic
1134695127 16:16218354-16218376 ACCAATGAACAGGCTGCAGCAGG - Intronic
1136086327 16:27887950-27887972 CCCAAGGGCCACCAGGCAGCGGG + Intronic
1136568737 16:31084626-31084648 CCCCAGGAGCTGCATGCAGCCGG + Exonic
1138205555 16:55121826-55121848 CCCAGGGACCTGCCTTGAGCTGG + Intergenic
1138211046 16:55163812-55163834 GCCAGGGACCAGGCTGGAGCTGG + Intergenic
1139177010 16:64700931-64700953 CACAAGGACCAGCCTGGCGGTGG - Intergenic
1139349535 16:66326603-66326625 CCCCAGCACCAGCATGAAGCCGG + Intergenic
1140467487 16:75194155-75194177 GCCCAGGAGCAGCCTGCAGAAGG + Intergenic
1140470247 16:75209709-75209731 CCCAAGTCCCAGCCTGGATCTGG - Intergenic
1140475643 16:75238179-75238201 CACCAGCACCAGCCTGAAGCGGG + Intronic
1141385933 16:83622392-83622414 CCAAAAGACCAGCCTTCATCAGG + Intronic
1141521073 16:84580048-84580070 CCCAGGCACCTGCCAGCAGCTGG - Intronic
1142239694 16:88939660-88939682 CCCAACGCCCAGACTGGAGCGGG + Intronic
1144524070 17:15975006-15975028 CTCGAGGACCACCCTCCAGCGGG + Exonic
1144573432 17:16415119-16415141 TCCAAGCACCAGCCAGCAGGTGG - Intergenic
1145813655 17:27780653-27780675 CCTAAAGCCCAGCCAGCAGCAGG - Intronic
1145975395 17:28981243-28981265 ACCAAGGGCCAGCCTGCAGGAGG - Intronic
1147516273 17:41120791-41120813 CCCAGGGACAAGCCTGAGGCTGG + Intergenic
1148054833 17:44787730-44787752 CCCAAGGACCGGACAGCAGTGGG - Intergenic
1151368242 17:73630838-73630860 CCCAAGGCCCAGGCTGAGGCTGG + Intronic
1151395693 17:73821244-73821266 TCCAATGCCCAGCCTGCAGGTGG + Intergenic
1151527504 17:74681071-74681093 CCCAAGGAGCTGCGTCCAGCAGG + Intronic
1151542506 17:74771709-74771731 CACAAGGCCCAGCCATCAGCAGG + Exonic
1151625278 17:75272074-75272096 CCCAAGGTCCAGGCTGCGGCGGG - Intergenic
1151817366 17:76477874-76477896 CCCAAGGCGCTGCCTGCAGGCGG - Intronic
1152207049 17:78979880-78979902 TCAAAGGACCAGTCTGCAGAGGG - Exonic
1152217749 17:79044253-79044275 CTGCAGGACCAGCCTCCAGCAGG - Intronic
1152375041 17:79914590-79914612 CCCTTCCACCAGCCTGCAGCAGG + Intergenic
1152962289 18:87031-87053 TCCAAGGTCCAGCCTGCAAGGGG + Intergenic
1153158930 18:2180872-2180894 CCCCAGGAGCAGCCTGCATCTGG - Intergenic
1153965866 18:10181745-10181767 CCCCAGTACCAGCCTGGAGTTGG - Intergenic
1154165047 18:12008570-12008592 CACAGGGACCAGCCTGCAGAAGG + Intronic
1156505624 18:37589435-37589457 CACAGAGACGAGCCTGCAGCTGG + Intergenic
1156894080 18:42224575-42224597 CCCAAAGACCAGTCAGCAGAGGG - Intergenic
1157483400 18:48070348-48070370 GCCAGAGACCAGCCTACAGCTGG - Intronic
1157601146 18:48893953-48893975 CCCATGGCCAAGCCTGCTGCAGG + Intergenic
1159695627 18:71553315-71553337 CCCAAGCAGAAGCCTGCTGCAGG + Intergenic
1159906621 18:74097963-74097985 CCCCAGTACCAGCCTGGAGCAGG + Intronic
1160040115 18:75337519-75337541 ACCAGGGTCCAGCCTGCTGCTGG + Intergenic
1160680598 19:410247-410269 CCCCAGGACCAACCCGGAGCCGG + Intergenic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1162566173 19:11446738-11446760 GCCAAGGCCCAGGCTGCAGATGG - Intronic
1163688344 19:18725031-18725053 CCCTTGGACCCGCCTGGAGCTGG + Intronic
1163821715 19:19499862-19499884 CCCCAGGTCCCTCCTGCAGCTGG - Intronic
1164069225 19:21750877-21750899 CCCCAGTACCAGCCTCAAGCTGG + Intronic
1164251788 19:23483497-23483519 CCCAAGTATCAGTCTGGAGCTGG + Intergenic
1164320113 19:24137052-24137074 CCCAAGTATCAGCCTGGAGCAGG - Intergenic
1164859174 19:31549130-31549152 CTCAAGGGCCAGCCAGCAGGTGG - Intergenic
1165020632 19:32921369-32921391 CCCAGAGACCCTCCTGCAGCTGG + Intronic
1165184361 19:34004027-34004049 CCAAAGCACCAGCCACCAGCTGG - Intergenic
1166090623 19:40506376-40506398 CCCAAGACTCACCCTGCAGCTGG - Exonic
1166355540 19:42225238-42225260 CCCCAGCACCAGCCCTCAGCAGG + Exonic
925020519 2:564433-564455 CCCACGGAAAAGCTTGCAGCTGG - Intergenic
926324264 2:11770834-11770856 CCCAAGAACCTGCCTGCACCAGG - Intronic
926838881 2:17056450-17056472 CCCAGGTTCCACCCTGCAGCAGG - Intergenic
926915939 2:17892734-17892756 CCCCAGGACCAGCCCAGAGCTGG - Intronic
930247858 2:49003454-49003476 CCCAAGGGCAAGTCTGCAGGAGG - Intronic
932085237 2:68751840-68751862 GGCCAGGACCAGCCTTCAGCAGG - Intronic
932451338 2:71812679-71812701 ACCAAGGTCCAGCCTGCATGGGG + Intergenic
932463243 2:71896960-71896982 CCCAGTCACCAGCCTGAAGCAGG + Intergenic
933661034 2:84927078-84927100 CTCAACTACCAGCCTGCAGTCGG + Intergenic
934556491 2:95289518-95289540 CCCAGGGTCCAGGCTCCAGCAGG - Exonic
934740173 2:96714826-96714848 CCCAAGGTCCAGCATGCCTCTGG - Intronic
934940693 2:98499894-98499916 CTAACTGACCAGCCTGCAGCTGG + Intronic
935821235 2:106894919-106894941 CCCAAGAACCTGCCTGCATGTGG - Intergenic
937057920 2:118954758-118954780 CCCCAGTACCAGCCTGGAGCTGG + Intronic
938068271 2:128293295-128293317 CCCAAGGGCCAGCCTGGGCCTGG + Intronic
945032996 2:205682512-205682534 GCGAGGCACCAGCCTGCAGCCGG + Exonic
945132057 2:206584158-206584180 CCCCAGTACCAGCCTGGAGCCGG - Intronic
945215796 2:207432751-207432773 TCCAAGGAACATCCTTCAGCAGG + Intergenic
945259341 2:207829858-207829880 CCCCAAGACCATCCTGCACCTGG - Intronic
945482519 2:210360492-210360514 CCTCAGTACCAGCCTGGAGCTGG - Intergenic
946622266 2:221572942-221572964 CCCAACGTCCAGTCCGCAGCAGG + Intronic
948233125 2:236366239-236366261 CCCTAGCCCCAGGCTGCAGCCGG + Intronic
949072549 2:242034490-242034512 CCTCAGGCCCAGCCTGCTGCTGG - Intergenic
1168841252 20:911395-911417 ACCAATGCCCACCCTGCAGCTGG - Intronic
1169020809 20:2329528-2329550 CCCAAGGCCCAGCATGAAGCAGG - Intronic
1172880680 20:38197922-38197944 GCCAAGTGCCAGCATGCAGCAGG - Intergenic
1173599051 20:44279882-44279904 CCCAAAAACCAGGCTGCAGTGGG + Exonic
1175313586 20:58028862-58028884 CCCAATGGCCAGCATGCAGCAGG + Intergenic
1175524840 20:59626533-59626555 CCCAAGCACATGCCTGCTGCAGG - Intronic
1175790434 20:61737118-61737140 CCCCAGGGCCAGCATCCAGCAGG - Intronic
1175964177 20:62652125-62652147 GCCAAGGAACAGCCTGACGCAGG - Intronic
1175993116 20:62799266-62799288 CCTGAGGACCTGCCTGCGGCGGG - Intronic
1176128534 20:63486729-63486751 CCCAGCTCCCAGCCTGCAGCCGG - Intergenic
1176367965 21:6045089-6045111 CCCAAGGGCTAGGCTGCAGTGGG + Intergenic
1178959106 21:37047703-37047725 CCCCAGTGCCAGCCTGGAGCCGG + Intergenic
1179188808 21:39106456-39106478 CCCAAGAGCAAACCTGCAGCTGG - Intergenic
1179454284 21:41488244-41488266 CCCAGGGCTCAGCCTGGAGCAGG + Intronic
1179755554 21:43493453-43493475 CCCAAGGGCTAGGCTGCAGTGGG - Intergenic
1181432925 22:22894012-22894034 CCCCGGGACCAGGCTGCATCCGG - Intronic
1181497789 22:23297595-23297617 CCCACAGTCCAGCCTGCATCTGG + Intronic
1181949353 22:26542875-26542897 CCAAGGGCCCAGTCTGCAGCTGG + Intronic
1182104786 22:27681690-27681712 GCCCAGAACCAGCCTGAAGCTGG + Intergenic
1182115888 22:27756148-27756170 CCCCAGGCACAGCCTGCAGAAGG - Intronic
1182164877 22:28163112-28163134 CTCAAGGACCGGGCTGCAGAGGG - Exonic
1182505566 22:30779855-30779877 AGCAAGGACCAGCCTTCACCGGG - Intronic
1182715255 22:32352942-32352964 CACAAGCTCCAGCCTCCAGCAGG + Intergenic
1182753281 22:32658418-32658440 CCCAAGGCCCAGTCTCCAGGAGG - Intronic
1184403455 22:44286895-44286917 CCCAAACACATGCCTGCAGCAGG - Intronic
1184449485 22:44574589-44574611 CCCAAGGACCACGCCACAGCGGG + Intergenic
1185063008 22:48616820-48616842 CCCACGGACCTGCAAGCAGCTGG - Intronic
1185235918 22:49712837-49712859 CCCAGAGCCCAGCCTGGAGCTGG - Intergenic
950447559 3:13047127-13047149 CCCAAGGACCAGCCTGCAGCCGG - Intronic
950714333 3:14837033-14837055 CACAGTGACCAGACTGCAGCAGG + Intronic
952743843 3:36760053-36760075 CCCTAGGACCAGCCTCCTGGAGG - Intergenic
953741536 3:45543025-45543047 CCCAAGGCCCAGCAGGAAGCTGG + Intronic
954092264 3:48294631-48294653 GCCTAGGACCAGCCTGATGCAGG - Exonic
954328598 3:49877241-49877263 CCCCAGGACCACCCCTCAGCCGG - Intergenic
954705917 3:52480423-52480445 CGCGAGGACCAGCCTGCAGAAGG - Intronic
954838733 3:53493972-53493994 CCCAGGTAACTGCCTGCAGCTGG - Intergenic
955050441 3:55405564-55405586 CCCAAGGACATCACTGCAGCTGG + Intergenic
955461550 3:59189306-59189328 CCCCAGTACCAGCCTGGAGCCGG - Intergenic
957245658 3:77712612-77712634 ACCAGGGACCAGACTGCAGAGGG + Intergenic
958969873 3:100600269-100600291 CCCCAGTACCAACCTGGAGCTGG - Intergenic
959722235 3:109505172-109505194 CCCTGGTACCAGCCTGGAGCTGG - Intergenic
960915115 3:122686993-122687015 CCCTGGGACCAGCCTGGAGATGG - Intronic
961659225 3:128459546-128459568 CCCTGGGACAAGCCGGCAGCTGG - Intergenic
962290311 3:134130670-134130692 CAGAAGGAGAAGCCTGCAGCTGG + Intronic
962530636 3:136277009-136277031 CCCCAGCACCAGCCTGGAGTTGG - Intronic
964160709 3:153641425-153641447 CACCAGTACCAGCCTGGAGCTGG + Intergenic
964668562 3:159200569-159200591 CCCAACCACCATCCTCCAGCAGG + Intronic
965216821 3:165874525-165874547 CCCCAGCACCAGCCAGGAGCTGG - Intergenic
968515551 4:1014114-1014136 GCCAAGGACCAGCATGCAGAGGG + Intronic
968550027 4:1217338-1217360 CCCAGGGACGAGGCTGCTGCAGG + Intronic
968642669 4:1722150-1722172 CCAAAGCACCAGCCTGGGGCCGG + Intronic
968960351 4:3740130-3740152 CCCAAGGACCAGGCTGAGGGAGG - Intergenic
969277990 4:6149906-6149928 CCCATGGCCCACCCTCCAGCTGG + Intronic
969411537 4:7031671-7031693 CCCCAGGACCAGCCTGCCAGCGG - Exonic
969435778 4:7188581-7188603 CCCAGTGCCCAGCCTGGAGCTGG + Intergenic
969461905 4:7333477-7333499 CACAGGGCCCAGCCTGCAGGAGG + Intronic
969682126 4:8649249-8649271 CGCCAGGCCCAGCCTGGAGCAGG + Intergenic
970215750 4:13758444-13758466 CCCAAGCACCAGCCTAGAGCTGG - Intergenic
971183053 4:24349100-24349122 CCCCAGTACCAGCCTGGAGCTGG - Intergenic
971473966 4:27055432-27055454 CCTGAGGACTGGCCTGCAGCTGG - Intergenic
972649877 4:41006423-41006445 CCCTAGGCCCAGTCTTCAGCTGG - Intronic
973994343 4:56441749-56441771 TCCAAGGACCAGATTACAGCAGG + Exonic
974951030 4:68582943-68582965 CCCCAGTACCAGCCTGGAGCTGG + Intronic
975034031 4:69658883-69658905 CCCCAGTACCAGCCCGGAGCTGG + Intergenic
975473628 4:74796921-74796943 CACACAGAACAGCCTGCAGCTGG + Intergenic
975517315 4:75260679-75260701 CCCCAGTACCAGCCTGGAGCCGG + Intergenic
976619600 4:87114702-87114724 TTCACGGACCAGCCTGCAGGGGG + Exonic
977293844 4:95191395-95191417 CCCAGGGTCCAGGCTGAAGCTGG + Intronic
977904286 4:102457612-102457634 CCCAAGGTCCAGCCTCCAAAGGG + Intergenic
978439263 4:108716505-108716527 GCCAAGGATCAGACTGCAGATGG + Intergenic
979487230 4:121283421-121283443 CACAAGGACTAGCCTAAAGCTGG - Intergenic
980869436 4:138594244-138594266 CTTAGGGACCAGCATGCAGCAGG - Intergenic
980940043 4:139265150-139265172 CCCAAGGAGCAGATTGAAGCTGG - Intergenic
983529415 4:168794151-168794173 CCACAGGACCATCCTGCAGGGGG - Intronic
983906335 4:173186255-173186277 CCCAAGGACAAGGTGGCAGCTGG + Intronic
985092972 4:186382305-186382327 CCCCAGTACCAGCCTAGAGCCGG + Intergenic
985217680 4:187671539-187671561 CCCCAGTACCAGCCCGGAGCCGG - Intergenic
985576220 5:674645-674667 CACCAGGACCTGCCAGCAGCTGG + Intronic
985964702 5:3330947-3330969 CACAAGAACCACCCTGAAGCCGG - Intergenic
987393807 5:17402031-17402053 CCCAAAGCCTAGCCGGCAGCTGG - Intergenic
990987770 5:61656507-61656529 TCCAAGGAACAGACCGCAGCAGG + Intronic
995727442 5:115196295-115196317 CTGAAGTACCAGCCTGGAGCCGG + Intergenic
995817880 5:116192005-116192027 CCCCAGTACCAGCCTGGAGCCGG + Intronic
996124079 5:119705737-119705759 CCCCAGTACCAGTCTGAAGCTGG - Intergenic
996288883 5:121828652-121828674 CCCTAGTACCACCCTGGAGCTGG - Intergenic
997585427 5:135040457-135040479 CCCAGCGACCATCCTGCTGCGGG + Intronic
999224525 5:150010197-150010219 CCCCAAGAGCAGCCTGCAGGAGG + Exonic
999261824 5:150243144-150243166 CCCAAGAACCAGCCTGATGGAGG + Intronic
1001313075 5:170624965-170624987 CCCAGGGAAGAGCCTGCATCTGG - Intronic
1001314011 5:170630011-170630033 CCCCAGGCCCAGCCTGGTGCAGG - Intronic
1002133202 5:177093644-177093666 CCCAAGCACCAGCCTGGAGATGG - Exonic
1002319174 5:178364880-178364902 CCCAGGCCCCAGCCTCCAGCAGG + Intronic
1002455545 5:179344149-179344171 CCCAGGGGCCCGCCTGCAACGGG + Exonic
1002535815 5:179874785-179874807 ACCAAGTGCCAGGCTGCAGCTGG - Intronic
1003395546 6:5749487-5749509 CCCAAGGAGGAGCTGGCAGCAGG - Intronic
1003516615 6:6823825-6823847 CCCAAGCATCAGGCTGAAGCTGG - Intergenic
1004005377 6:11633095-11633117 CACAAGGACTAGCCTACACCTGG - Intergenic
1004317408 6:14601754-14601776 CTCTGGGTCCAGCCTGCAGCTGG - Intergenic
1004881917 6:20017232-20017254 CAAAAGGCCCAGCCAGCAGCAGG + Intergenic
1005191357 6:23228105-23228127 CCCCAGCACCAGCCCACAGCCGG - Intergenic
1006011876 6:31049165-31049187 CCCAGCCTCCAGCCTGCAGCAGG - Intergenic
1006343314 6:33459333-33459355 CCAAAGGACCAGCCATCAGAAGG + Intergenic
1006435073 6:34021791-34021813 CCACAGGCTCAGCCTGCAGCTGG - Intronic
1007614070 6:43170456-43170478 CCCCAAGTCCAGCCTGCAGCTGG + Intergenic
1007767615 6:44170179-44170201 CGCAAGACCCAGGCTGCAGCAGG - Intronic
1007923112 6:45628647-45628669 CCCCAGAACCAGCTTTCAGCAGG - Intronic
1008564597 6:52754828-52754850 CCCAAGGCCCAGCCTGCTGCTGG + Intronic
1008568909 6:52796067-52796089 CCCAAGGCCCAGCCTGCTGCTGG + Intronic
1008573373 6:52836121-52836143 CTCAAGACCCAGCCTGCTGCTGG + Intronic
1008575703 6:52858165-52858187 CCCAAGGCCCAGCCTGCTGCTGG + Intronic
1008580464 6:52902231-52902253 CCCAAGGCCCAGCCTGCTCCTGG + Intronic
1009829014 6:68905614-68905636 GTCATGGACCAGCCTGCAGCAGG - Intronic
1009968897 6:70605340-70605362 CCCCAGTACCAGCCTGGAGCTGG + Intergenic
1010756242 6:79669136-79669158 CAGAAGGACCAGCGTGCAGGAGG - Intronic
1015877907 6:137842672-137842694 CCTCAGTACCAGCCTGGAGCTGG - Intergenic
1017409261 6:154151339-154151361 CCCAGGGACCAGGCTGAATCTGG - Intronic
1017740647 6:157403841-157403863 CTCATGGACCCGCCTGCAGGAGG + Intronic
1017891608 6:158644283-158644305 CCCCAGCCCCAGCCTGGAGCGGG - Intronic
1019685909 7:2382084-2382106 ACCAAGGCCATGCCTGCAGCAGG - Intergenic
1022856033 7:34315565-34315587 TCCAGTGACCAGCCTGGAGCGGG + Intergenic
1023436246 7:40143393-40143415 CCCAAAGTCCAGCATGCTGCGGG - Intronic
1023537498 7:41228997-41229019 CCCAATGACCATTCTGGAGCAGG + Intergenic
1023862716 7:44225699-44225721 CCCCAGGCCCAGCCTGCAGAGGG + Intronic
1026513843 7:71049742-71049764 CACAGGGCCCAGCCTGGAGCTGG - Intergenic
1027137943 7:75638311-75638333 ACCAAGGAGCAGCCTTCAGCCGG - Intronic
1029257209 7:99277700-99277722 CCCCACGTACAGCCTGCAGCTGG - Intergenic
1035757336 8:2044014-2044036 GCCAAGGACCAGCGAGCAGGTGG - Intergenic
1037713536 8:21376143-21376165 CCCCAGTACCAGCCTGGAGCTGG - Intergenic
1037855134 8:22366507-22366529 CCCAAGGCCCAGGTGGCAGCGGG + Intergenic
1037874226 8:22531560-22531582 GCCAAGGTCCAGCATGCACCAGG - Intronic
1039571901 8:38593397-38593419 CCTCAGTACCAGCCTGGAGCCGG + Intergenic
1039641534 8:39228020-39228042 CACCAGTACCAGCCTGGAGCTGG + Intronic
1042122808 8:65507032-65507054 CCCCAGCACCAGCCTGGAGCTGG - Intergenic
1043346755 8:79307086-79307108 CACATGGACCAGCCTGCCACTGG + Intergenic
1043816824 8:84812298-84812320 CCCCAGTACCAGACTGGAGCTGG - Intronic
1043892361 8:85661550-85661572 CGCAAGCGCCTGCCTGCAGCTGG - Intergenic
1045521267 8:102905100-102905122 CTCCAGGAGCAGCGTGCAGCTGG - Intronic
1045705755 8:104920618-104920640 CCTAAGGATCAGACTGGAGCAGG + Intronic
1047130693 8:122017070-122017092 CCCCAGTACCAGCCCGGAGCCGG - Intergenic
1048164318 8:132048891-132048913 CCAAAGGGCCTGCCTGCAGGGGG + Intronic
1049799573 8:144511585-144511607 CCCCAGCCCCAGCCTGCAGCGGG + Intronic
1049799593 8:144511638-144511660 CCCCAGCCCCAGCCTGCAGCGGG + Intronic
1050074872 9:1853035-1853057 CCCAAGGAGAAGCCTGCTACAGG + Intergenic
1051546299 9:18279876-18279898 CACCAGGACCAGCCTGGTGCTGG + Intergenic
1051576524 9:18622316-18622338 CCCTCGGACCAGCCGGCAGGTGG - Exonic
1051659072 9:19409108-19409130 CCGAGCTACCAGCCTGCAGCTGG - Exonic
1053416302 9:37948899-37948921 CCCCAGGACCCGGCAGCAGCAGG - Intronic
1054346315 9:63968764-63968786 CCCCAGTACCAGCCTGGAGTCGG - Intergenic
1055905749 9:81292080-81292102 CTCCAGTACCAGCCTGGAGCTGG - Intergenic
1056760136 9:89408686-89408708 TCCAAGGCCCTGCCTGCCGCAGG - Intronic
1057536143 9:95908622-95908644 ACCAAGGCCCAGCCTACTGCTGG - Intronic
1057915664 9:99053383-99053405 CCCAAGGTCCACCTTGCATCAGG - Intronic
1057998796 9:99844655-99844677 CCCACTGACCAGGCTGCTGCAGG + Exonic
1058156664 9:101524035-101524057 CCCCAGTACCAGCCCGGAGCTGG - Intronic
1058770741 9:108228695-108228717 CCCCAGTACCAGGCTGGAGCTGG + Intergenic
1059391870 9:114004345-114004367 GCCAAGGACCAGGCTGAGGCTGG - Intronic
1060213119 9:121722549-121722571 CCCAAGGCCCTGCATACAGCAGG - Intronic
1060933651 9:127503996-127504018 CCCAAGGAAGAGGCTGCACCTGG - Intergenic
1061852070 9:133422238-133422260 AGCAAGGCCCAGCTTGCAGCAGG + Exonic
1062073671 9:134572772-134572794 GCCCAGGACCTGCATGCAGCAGG - Intergenic
1062117959 9:134819163-134819185 CCCCACCACCAGCCTGCAGCAGG - Intronic
1062215008 9:135384420-135384442 GCCAAAGTCCAGCCTCCAGCAGG + Intergenic
1062282472 9:135758177-135758199 CCCACGGGGCAGCCTGCACCTGG - Intronic
1062282484 9:135758223-135758245 CCCATGGGGCAGCCTGCACCTGG - Intronic
1062378354 9:136275098-136275120 CCCAAGGAGGAGCCTGAAGCTGG + Intergenic
1062735853 9:138137086-138137108 TCCAAGGTCCAGCCTGCAAGGGG - Intergenic
1186412874 X:9359294-9359316 CCCTGGGACCAGCGTTCAGCTGG - Intergenic
1186901785 X:14065398-14065420 CCCAAGGATCAGGCTGAGGCAGG - Intergenic
1187515907 X:19969711-19969733 CCCAAGAACCTGCCTGTAGCAGG + Intronic
1187773540 X:22730141-22730163 CCCCAGTACCAGCCTGGACCCGG - Intergenic
1189409627 X:40758600-40758622 CCCAAACCCCAGCCTGCAGTGGG + Intergenic
1189413660 X:40794914-40794936 CCCCAGTACCAGCCTGGAGCCGG + Intergenic
1190062156 X:47218627-47218649 CCAAAGGACCCGTCCGCAGCGGG - Intronic
1190101806 X:47527808-47527830 CCCAAGTACCAGCCTGTGACGGG - Intergenic
1193077077 X:77365358-77365380 CCCCAGTATCAGCCTGGAGCCGG + Intergenic
1193205200 X:78739790-78739812 CCCAAGCAAAAGCCTGCTGCAGG - Intergenic
1193253334 X:79319108-79319130 CCCCAGTACCAGCCCGGAGCTGG - Intergenic
1193643825 X:84043650-84043672 CCCCAGCACCAGCCAGGAGCTGG - Intergenic
1193779590 X:85685865-85685887 CCCCAGTACCAGCCTGGAGCCGG - Intergenic
1194926851 X:99836152-99836174 CCCCAGTACCAGCCTGGAGCCGG - Intergenic
1196464891 X:115961250-115961272 CCCCAGTACCAGCCTGGAGCTGG + Intergenic
1196737556 X:118992860-118992882 CCCCAGTACCAGCCTGGAGCCGG + Intronic
1197066169 X:122236898-122236920 CCCTAGTACCAGCCTGGAGCTGG - Intergenic
1198113748 X:133525017-133525039 CCTCAGAACCAGCCTGGAGCAGG + Intergenic
1199421572 X:147650465-147650487 CCCAAGCATAAGCCTGCTGCAGG + Intergenic
1199521444 X:148740948-148740970 CCCCAGTACCAGCCTGGAGCTGG - Intronic
1199668597 X:150121633-150121655 CCCCAGTACCAGCCTGGAGTTGG + Intergenic