ID: 950450014

View in Genome Browser
Species Human (GRCh38)
Location 3:13060223-13060245
Sequence TACTCTCCCATGGTGCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950450014_950450026 26 Left 950450014 3:13060223-13060245 CCAGTCAGCACCATGGGAGAGTA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 950450026 3:13060272-13060294 CATGTTGGGATGCAAAGAGGAGG 0: 1
1: 0
2: 4
3: 20
4: 363
950450014_950450025 23 Left 950450014 3:13060223-13060245 CCAGTCAGCACCATGGGAGAGTA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 950450025 3:13060269-13060291 GTGCATGTTGGGATGCAAAGAGG 0: 1
1: 0
2: 3
3: 15
4: 193
950450014_950450022 -3 Left 950450014 3:13060223-13060245 CCAGTCAGCACCATGGGAGAGTA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 950450022 3:13060243-13060265 GTAAGGCGGGGAGGTGGAAATGG 0: 1
1: 0
2: 0
3: 26
4: 430
950450014_950450024 12 Left 950450014 3:13060223-13060245 CCAGTCAGCACCATGGGAGAGTA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 950450024 3:13060258-13060280 GGAAATGGTCTGTGCATGTTGGG 0: 1
1: 0
2: 2
3: 21
4: 228
950450014_950450021 -9 Left 950450014 3:13060223-13060245 CCAGTCAGCACCATGGGAGAGTA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 950450021 3:13060237-13060259 GGGAGAGTAAGGCGGGGAGGTGG 0: 1
1: 0
2: 9
3: 112
4: 1318
950450014_950450023 11 Left 950450014 3:13060223-13060245 CCAGTCAGCACCATGGGAGAGTA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 950450023 3:13060257-13060279 TGGAAATGGTCTGTGCATGTTGG 0: 1
1: 0
2: 2
3: 19
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950450014 Original CRISPR TACTCTCCCATGGTGCTGAC TGG (reversed) Intronic
900816493 1:4851213-4851235 AACTCTCCCATCATGGTGACAGG + Intergenic
902852432 1:19170675-19170697 TTCTCTCCCTTGGTGCCTACTGG - Intronic
903419806 1:23210517-23210539 GACTCCCTCATGATGCTGACAGG + Intergenic
904300671 1:29551365-29551387 TGGTTTCCCGTGGTGCTGACTGG - Intergenic
911301546 1:96180532-96180554 TACCCTCACATTTTGCTGACAGG - Intergenic
912643713 1:111371214-111371236 TACTCTCCCAGTTTGCTGACTGG + Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
915448403 1:155988204-155988226 TAGTCTCCCATAGTGCTCCCAGG + Intronic
919977638 1:202623203-202623225 TCCTCTCCCATGGGGATGGCGGG - Intronic
922546470 1:226461213-226461235 GACTCTCCCTTGGAGCTGTCTGG + Intergenic
1064098919 10:12446377-12446399 TAAACTGTCATGGTGCTGACAGG + Intronic
1064450142 10:15434767-15434789 TAATCTTCCAGGGTGCTGCCAGG + Intergenic
1066299572 10:34084869-34084891 TACTTTGTCATGGTGCTGAGTGG + Intergenic
1069321795 10:67180964-67180986 TACTTCCTCATGGTGCTGTCAGG - Intronic
1069807939 10:71137629-71137651 TAAGGTCCCATGGTGGTGACTGG - Intergenic
1069813525 10:71179409-71179431 TACTGTCCCATGGTGCCTATGGG - Intergenic
1075844047 10:125530682-125530704 AACTCTGCCCTGCTGCTGACAGG - Intergenic
1076666499 10:132095965-132095987 TACTGTCCCATGCTGCTGTTAGG + Intergenic
1078269858 11:9785215-9785237 TCCTCCCCCATGCTGCTGTCTGG + Exonic
1078726886 11:13939941-13939963 ATCTCTCCCATGGGGCTCACTGG + Intergenic
1082573051 11:54765728-54765750 CAGTCTCCCATAGTGCTGCCAGG + Intergenic
1084773315 11:71358063-71358085 TACTCTCCCATAATGCAGATGGG - Intergenic
1085741335 11:79080523-79080545 GCCTCTCCCATTGTGTTGACTGG + Intronic
1085795624 11:79536985-79537007 TAGTCTCCCATCTTGCTGAATGG - Intergenic
1087906062 11:103699432-103699454 TAAGCTCCCATGGAGCTGAGAGG + Intergenic
1087909287 11:103734780-103734802 TACTTTCCTAGGGTGCTCACTGG + Intergenic
1089534190 11:119150391-119150413 TAGTATCCCATGGTGCTCACAGG - Intronic
1092312453 12:7373362-7373384 TTCGCTCCCATGGGGCAGACAGG + Exonic
1092975940 12:13745034-13745056 TCCTCTCAAATGGTGCTGTCAGG - Intronic
1094464040 12:30731661-30731683 TACACTTTCATGGTACTGACTGG + Intronic
1095198656 12:39356051-39356073 TGCTCCCCCATGGAGCTGACTGG + Intronic
1096758889 12:53823263-53823285 CACTCTCCCCTGCTGCTGGCTGG - Intergenic
1100205345 12:92342704-92342726 TCCTCTCCCAAGGTGCAGCCTGG + Intergenic
1101413764 12:104491209-104491231 TACTCTCCAATGGTGATGAAGGG - Intronic
1104531791 12:129578848-129578870 TACTCACCCACTTTGCTGACAGG + Intronic
1104906257 12:132215019-132215041 CACCCTCCGCTGGTGCTGACTGG + Intronic
1108383465 13:49876115-49876137 TGTTCTCCCATGGTGCTGTTTGG + Intergenic
1108507743 13:51128060-51128082 TAAACTCTCATGGTGCTGATGGG - Intergenic
1108911363 13:55555891-55555913 TACTGTCCCATTGTGGAGACAGG - Intergenic
1114925429 14:27391398-27391420 TACTGGCCCATGGAACTGACTGG - Intergenic
1118913641 14:70082662-70082684 TACACTCCCATGGGGCTTACAGG - Intronic
1119993793 14:79229565-79229587 TACTCCTCCATCCTGCTGACAGG - Intronic
1123170788 14:106371064-106371086 TGCTGTCCTGTGGTGCTGACAGG + Intergenic
1123194451 14:106603305-106603327 TGCTGTCCTGTGGTGCTGACAGG + Intergenic
1123222409 14:106869638-106869660 TGCTGTCCTGTGGTGCTGACAGG + Intergenic
1128795538 15:70463747-70463769 TAGTCTCCCCTGGAGCTGACAGG - Intergenic
1129881614 15:79010380-79010402 CACTCTCCCATTTTGCAGACAGG - Intronic
1130615826 15:85406911-85406933 TACTCTCCCTTGGTTCTTTCAGG - Intronic
1130646837 15:85735854-85735876 AACTCTACCATGGTCCTGGCAGG + Intronic
1137464788 16:48698173-48698195 TACTCTCTCATGATGCTTTCTGG + Intergenic
1139245145 16:65434327-65434349 GATTCTCCCATGGTGCAGGCAGG + Intergenic
1139961377 16:70719752-70719774 AACTCTCCCACAATGCTGACGGG + Intronic
1143286941 17:5797174-5797196 TGCTCTGCCATGTTTCTGACGGG + Intronic
1155900389 18:31382187-31382209 TACTCTACCATCGTGATAACTGG + Intronic
1165905802 19:39193967-39193989 TCCTCCCCCATGGCGATGACAGG + Intergenic
1166669807 19:44703084-44703106 AACTCTCACATGGGGATGACAGG - Intronic
1168142258 19:54396269-54396291 TGGTCTCCCAAAGTGCTGACAGG - Intergenic
926194416 2:10753906-10753928 TACTGTCACATGCTGCTGGCAGG - Intronic
926391593 2:12399615-12399637 TACTTTGCTATGGTGCTGAGAGG + Intergenic
926663276 2:15492208-15492230 TCCTCTGGCATGGTGGTGACTGG - Intronic
928256924 2:29730779-29730801 TAGCCTCCCAGTGTGCTGACAGG + Intronic
929220512 2:39460168-39460190 AACTCTCCTATGCTGCTCACAGG + Intergenic
936686771 2:114836733-114836755 CAGTCTCCCATAGTGCTCACAGG - Intronic
940651296 2:156443611-156443633 TTCCCTCCCAAGGTGCTGAGAGG + Intronic
942194324 2:173502664-173502686 TAAACTGCCATGGTGCTGATGGG - Intergenic
1175287479 20:57846621-57846643 CATTCTCCCTTGGAGCTGACAGG + Intergenic
1178450440 21:32693659-32693681 AACCCTTACATGGTGCTGACTGG + Intronic
1181161691 22:20963552-20963574 TACTCTCCCAGACTGCTGCCAGG - Intergenic
1182622962 22:31627833-31627855 CATTCTCCCATGGTGCTGTGAGG + Intronic
1185260840 22:49861966-49861988 CCCTCTCCCACAGTGCTGACAGG - Intronic
950450014 3:13060223-13060245 TACTCTCCCATGGTGCTGACTGG - Intronic
950563628 3:13750755-13750777 TGCTCTCCCATTGTGCAGATGGG - Intergenic
951715156 3:25634704-25634726 TGCACTCCCATGGTGCTAGCTGG + Intronic
952321956 3:32285998-32286020 AATTCTCCCATCGTCCTGACAGG - Intronic
952762065 3:36923693-36923715 TATTCTCGGAGGGTGCTGACTGG - Intronic
956061294 3:65350777-65350799 CGCTCTCCCATGGTGCTGTGAGG + Intergenic
962875141 3:139530334-139530356 TACTCTCCCATTTTACAGACAGG - Intronic
966619870 3:181952340-181952362 TTCTCTCCCATGGTGCTCCTGGG - Intergenic
970517632 4:16849190-16849212 TTCTCTCCCAAGATGCTCACAGG + Intronic
971744025 4:30555933-30555955 CACTCTCATATGTTGCTGACAGG - Intergenic
974840222 4:67290804-67290826 TATTCTTCCTTGGTGCTGAGGGG - Intergenic
975001238 4:69224989-69225011 TCCTTTGCCATGGTGCTGCCAGG - Intergenic
976391449 4:84508926-84508948 AACTCTCCCATGGGGCTGGGCGG - Intergenic
977953151 4:102997045-102997067 CAGCCTCCCATAGTGCTGACAGG + Intronic
982553199 4:156828110-156828132 AACTCTTCCAAAGTGCTGACGGG + Intronic
983372705 4:166882387-166882409 CACTGTACCATGGTGCTGTCTGG + Intronic
983550752 4:169015174-169015196 TGCTCTCCCATGGTACTTCCTGG - Intergenic
984008302 4:174340256-174340278 TACTCTCACATGCTGCTGATAGG - Intergenic
984947259 4:184979572-184979594 CACTCTGCCCTGGGGCTGACAGG - Intergenic
985618207 5:937301-937323 ATCTCTCCCATCGTGCTGAAGGG + Intergenic
986795296 5:11204301-11204323 TATTCTCCCCTGGTGCAAACTGG - Intronic
988353863 5:30147254-30147276 AATTCTCCAATGGTGCTGATTGG - Intergenic
989318909 5:40112320-40112342 TAGTCTCCCATAGTGCTCCCAGG + Intergenic
992389900 5:76321064-76321086 TCCTTTCCCATGGTGCAGAAAGG + Intronic
994114236 5:96044120-96044142 TACTTTCCCATGCTGCTGTTAGG + Intergenic
994238782 5:97395657-97395679 TAAACTGTCATGGTGCTGACAGG - Intergenic
996684857 5:126268951-126268973 TAAACTGCCATGGTGCTGATGGG + Intergenic
1002865604 6:1119428-1119450 CACTCTCCCATGGTGCCTTCTGG - Intergenic
1013480035 6:110545130-110545152 CACTCTCCCACGGTTCTGAGAGG + Intergenic
1018406248 6:163485652-163485674 TTCTCTCCCATTGTGTTGATGGG + Intronic
1028125484 7:87108082-87108104 CACTGTCCCATGGTGGGGACAGG - Intergenic
1031811636 7:126376964-126376986 TACTCTCTCATAGTTCTGAAGGG + Intergenic
1031859469 7:126961531-126961553 TAGGATCCCATGGTGCTGACAGG - Intronic
1034269131 7:149795219-149795241 TATTCTCCCCTGGGGCTGGCCGG + Intergenic
1034330527 7:150278415-150278437 TGCTCTCCAATGGTGCTCAGTGG - Intronic
1035671844 8:1424066-1424088 TACTCTCCCATGGCACTCAGAGG + Intergenic
1035719743 8:1783086-1783108 CACTTTCCCATGGTCCTCACTGG + Exonic
1040003853 8:42601398-42601420 CACTCTCCCAGGGGGCTCACAGG - Intergenic
1041163190 8:55065723-55065745 CACTCCCCTATTGTGCTGACTGG + Intergenic
1048794213 8:138133774-138133796 TACTCTCCCCTGCTGATAACTGG - Intronic
1050254449 9:3779431-3779453 TACTCTCCCTTGGTTCTCATGGG - Intergenic
1051408964 9:16769394-16769416 TTCTCTCCCATTTTACTGACAGG + Intronic
1052009495 9:23389156-23389178 TAGTCTCCCATAGTGCTCCCAGG - Intergenic
1054927972 9:70607214-70607236 TACTCTCCCAAGTTTCTGAAAGG - Intronic
1055686632 9:78782042-78782064 TTCTCTCCCATGGGCCAGACTGG + Intergenic
1057028737 9:91757155-91757177 TGCTCTCCCCTCGTGCTGACTGG + Intronic
1059566034 9:115383708-115383730 TACTCTCCTTTGGTGCTGTTTGG - Intronic
1061741320 9:132708473-132708495 TCCTCTCCCCAGGTGCTGAAGGG + Intergenic
1062448470 9:136605518-136605540 TCCTCTCACATGGAGCAGACGGG - Intergenic
1189134456 X:38534207-38534229 ACCTCTTCCATGGTGCTGGCTGG + Intronic
1189147473 X:38669904-38669926 GACTCTCCCATTTTGCTGATGGG - Intronic
1190605150 X:52133917-52133939 CCCTCTCCCATAGTGATGACTGG + Intergenic
1196383205 X:115117323-115117345 AACTCTCACATACTGCTGACAGG + Intronic