ID: 950450075

View in Genome Browser
Species Human (GRCh38)
Location 3:13060499-13060521
Sequence CTGGCTTTCCACCGATGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950450066_950450075 6 Left 950450066 3:13060470-13060492 CCTGCAGTCTCAGGGCCTGACTC 0: 1
1: 0
2: 2
3: 29
4: 226
Right 950450075 3:13060499-13060521 CTGGCTTTCCACCGATGGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 86
950450068_950450075 -9 Left 950450068 3:13060485-13060507 CCTGACTCCATGCCCTGGCTTTC 0: 1
1: 0
2: 4
3: 40
4: 394
Right 950450075 3:13060499-13060521 CTGGCTTTCCACCGATGGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 86
950450065_950450075 12 Left 950450065 3:13060464-13060486 CCAGCTCCTGCAGTCTCAGGGCC 0: 1
1: 2
2: 4
3: 50
4: 457
Right 950450075 3:13060499-13060521 CTGGCTTTCCACCGATGGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950450075 Original CRISPR CTGGCTTTCCACCGATGGGC GGG Intronic
900500570 1:3002507-3002529 CCGGCTTGCCACCAAAGGGCTGG + Intergenic
901741126 1:11342723-11342745 TTGGCTTTCCAGCGAGCGGCTGG + Intergenic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
905889311 1:41509676-41509698 CTGGCACTCCACAGGTGGGCAGG - Exonic
907502001 1:54887524-54887546 GTGGCTTTCCGCCGGAGGGCTGG + Intergenic
915677410 1:157544487-157544509 CTGGGTTCCCGCTGATGGGCTGG + Exonic
919740346 1:200977376-200977398 CTTGCCTTTCTCCGATGGGCAGG - Exonic
923434696 1:233956897-233956919 CTGGCATTCCACCACTAGGCGGG - Intronic
1065894603 10:30152224-30152246 CTGGCTTTCCCCCGCTTAGCTGG - Intergenic
1072093299 10:92150948-92150970 TTGGCTTTCAACCAATGGTCTGG + Intronic
1076982270 11:210929-210951 CTGGGTTTCCAGAGATGGTCTGG + Intronic
1090537813 11:127664047-127664069 ATGGCTTTCCTCCGATGAGTAGG - Intergenic
1090984031 11:131750066-131750088 ATGGCTTTCCACCTAAGGTCAGG - Intronic
1094303980 12:28997246-28997268 CTGGAGTTCCACCCATGGCCTGG - Intergenic
1099087613 12:78264673-78264695 CTGTCTTTCCACAGATAGCCTGG + Intergenic
1101623317 12:106412488-106412510 ATGGCTTTTCACCTAAGGGCAGG - Intronic
1103637225 12:122317486-122317508 CTGGCTTTCCACCAAGAGCCAGG - Intronic
1105610791 13:21968176-21968198 CTGGCATCCCACCTTTGGGCTGG + Intergenic
1107199772 13:37700337-37700359 CTGGCCTTCCATGAATGGGCTGG + Intronic
1107385923 13:39908875-39908897 AGGGATTTCCACCGATGGGATGG + Intergenic
1115531149 14:34328396-34328418 CTGGATTTCCAGCTATGGGAAGG - Intronic
1123122648 14:105925147-105925169 CTGGCTTTCCATGCACGGGCAGG + Intronic
1125971212 15:43913200-43913222 AAGGCTTTCCACTGCTGGGCAGG + Intronic
1126063061 15:44802574-44802596 CTGGCTTTCCACTGAGATGCAGG + Intergenic
1130825876 15:87545984-87546006 CTGGCTTTCCAGCAATGGGTGGG + Intergenic
1132331462 15:101015022-101015044 CCGGCTTTCCACCTATTGGAAGG - Intronic
1132601366 16:774564-774586 CTGGGTGTCCACAGAGGGGCAGG - Intronic
1133211911 16:4267986-4268008 CAGGGTTCCCACTGATGGGCTGG - Intronic
1137404021 16:48176111-48176133 CAGGGTTTCCACCAATCGGCAGG + Intronic
1137859540 16:51832230-51832252 CTAGCCTTCCACGGATGGGCTGG - Intergenic
1141035501 16:80622200-80622222 CTGCCTGTCCACCCCTGGGCTGG - Intronic
1144319176 17:14096874-14096896 CTGGCTTTCCACCCAGGAGTGGG + Intronic
1145367753 17:22278782-22278804 CTAGATATCCACAGATGGGCTGG - Intergenic
1145994951 17:29099801-29099823 CTGCCTTTCCTCTGCTGGGCTGG - Intronic
1146469406 17:33111917-33111939 CTGTCTCTCCCCAGATGGGCAGG + Exonic
1147863891 17:43540720-43540742 CTGGCTTTGCATCCCTGGGCAGG - Intronic
1151459549 17:74246301-74246323 CTGGGTTTCCACTGCTGGGAAGG - Intronic
1151571329 17:74927343-74927365 CAGGCTTTCCACCCTGGGGCAGG + Intronic
1152637887 17:81437628-81437650 CTGGCTTTCCTGTGCTGGGCAGG + Intronic
1152942922 17:83181942-83181964 CTGGCTTTCCACGCCTGGGGGGG + Intergenic
1154297648 18:13164513-13164535 CTGGGTGTCCCCCGCTGGGCCGG - Intergenic
1156312341 18:35936060-35936082 CTGGCTTTCCTCGGCAGGGCAGG - Intergenic
1157729458 18:49991012-49991034 CTGGCCTTACACCGGTGGGGTGG + Intronic
1160328295 18:77969628-77969650 CTGGCTTTCTTCCCAGGGGCAGG + Intergenic
1164616767 19:29671782-29671804 CTGGCTTTCTACTGGTGGCCAGG + Intronic
927859862 2:26553839-26553861 CTTGCTTCCCACCTATGGGCTGG + Intronic
929895855 2:45960432-45960454 CAGTTTTTCCACTGATGGGCAGG + Intronic
932347835 2:71007298-71007320 CTGGCTTTCCACCCCTCTGCTGG + Intergenic
932403488 2:71498312-71498334 CTGGCCTGCCACAGGTGGGCAGG + Intronic
942789695 2:179746245-179746267 CTGGCTTTTCAACAATGAGCAGG + Intronic
946334421 2:219027895-219027917 CAGGCTCTACACTGATGGGCGGG + Exonic
949030480 2:241794556-241794578 CTGGCTTTCCAGCTCTGGGCAGG - Intronic
1170067366 20:12327944-12327966 CTGACTTTACAAGGATGGGCTGG - Intergenic
1173857619 20:46260815-46260837 CTGGCTTTCCGCCTATGGACAGG + Intronic
1176198034 20:63846579-63846601 CTGGCTGTCCAGCGGAGGGCGGG - Intergenic
1180091970 21:45537927-45537949 CTGCTTCTCCACCGCTGGGCTGG + Exonic
1180839467 22:18952416-18952438 CTGGGTCTTCACCTATGGGCAGG - Intergenic
1181062433 22:20288063-20288085 CTGGGTCTTCACCTATGGGCAGG + Intergenic
1183320731 22:37163677-37163699 CTGGCTTTCCCCCGAATGGGGGG - Intronic
1183382674 22:37498265-37498287 CTGGTTTTCCTCCCATGGGCAGG + Intronic
1184865083 22:47197784-47197806 CTGTCTTTCCACCGAGGTCCAGG + Intergenic
950443228 3:13021981-13022003 CTGGCTGTCGACTGTTGGGCCGG - Intronic
950450075 3:13060499-13060521 CTGGCTTTCCACCGATGGGCGGG + Intronic
952525005 3:34200713-34200735 CTGGCTTTCCACTGAGATGCAGG - Intergenic
954028787 3:47803390-47803412 CTGGCTGCCCACGGATCGGCCGG - Intronic
955818757 3:62874733-62874755 CTCGCTCACCACCGACGGGCTGG + Exonic
962954597 3:140252877-140252899 CTGGCTTTCATCAGATGAGCTGG - Intronic
963120932 3:141776598-141776620 TTGGCTTTGCACCGCTGCGCTGG - Intergenic
964684024 3:159375321-159375343 CTGAATTTTCACAGATGGGCAGG + Intronic
970576980 4:17437304-17437326 CTGGCTATCCACCGGTGGAATGG - Intergenic
971200810 4:24507821-24507843 CTGGTTTTCCAGCAGTGGGCAGG - Intergenic
973229488 4:47825228-47825250 CTGGCTTTCCATCGCTGATCCGG - Intronic
976369323 4:84268705-84268727 CTGGCTTTCCTCCTATTAGCTGG + Intergenic
985888291 5:2696899-2696921 CTGAATTTCCACGGTTGGGCAGG + Intergenic
986610322 5:9560818-9560840 CTGGCTTTGCAAAGCTGGGCAGG - Intergenic
991977016 5:72193564-72193586 CTGGCATTCCCCTGCTGGGCAGG + Intronic
992004938 5:72468146-72468168 CTGGCATTCCTGCGATTGGCAGG + Intronic
1001686243 5:173597001-173597023 TTGGCTTTCCACCAATGTCCAGG + Intergenic
1002332780 5:178455817-178455839 CTGGCTTCCTCCTGATGGGCGGG - Intronic
1007820275 6:44555794-44555816 CTGGCTTTCCTGGCATGGGCTGG - Intergenic
1013052269 6:106548020-106548042 TTGGCCTTCCACGGAAGGGCAGG + Intronic
1016531394 6:145061393-145061415 CTGGGTTTCTACCCAGGGGCCGG + Intergenic
1024971440 7:55075095-55075117 CTGGCTGCCCACTGATGGTCTGG - Intronic
1024980569 7:55154320-55154342 CTGGCTTGCTACCGAGGAGCGGG + Intronic
1025925201 7:65953333-65953355 TTTACTTTCCACAGATGGGCAGG + Intronic
1037220189 8:16509779-16509801 CTGGCTTCCCTCCGTAGGGCAGG - Intronic
1044862889 8:96540561-96540583 CTGGCTTCCTAAAGATGGGCGGG - Intronic
1048800665 8:138191228-138191250 CTGGCTGTCCAGCATTGGGCAGG - Intronic
1051335608 9:16063322-16063344 CAGGCTTGCCACGGATGGTCTGG + Intergenic
1185965120 X:4591389-4591411 ATGGCTTTCCATCGATGAGGGGG + Intergenic
1186295965 X:8148737-8148759 CTAGCTTTACACCAAAGGGCTGG + Intergenic
1190330101 X:49230539-49230561 CTGGCTTTCCCCCGGTGTGCGGG + Exonic
1190714766 X:53094084-53094106 CTGCCTTTCCAGGGATTGGCTGG - Intergenic
1199079074 X:143556315-143556337 CAGTATTTCCACCGATGGGTGGG - Intergenic