ID: 950450350

View in Genome Browser
Species Human (GRCh38)
Location 3:13061720-13061742
Sequence CAGACTTGCCCCAAACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 488}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950450346_950450350 10 Left 950450346 3:13061687-13061709 CCTCTGCACACTACTGAGGCTGC 0: 1
1: 0
2: 0
3: 14
4: 193
Right 950450350 3:13061720-13061742 CAGACTTGCCCCAAACTGCCAGG 0: 1
1: 0
2: 2
3: 24
4: 488
950450344_950450350 16 Left 950450344 3:13061681-13061703 CCTGGGCCTCTGCACACTACTGA 0: 1
1: 0
2: 1
3: 20
4: 203
Right 950450350 3:13061720-13061742 CAGACTTGCCCCAAACTGCCAGG 0: 1
1: 0
2: 2
3: 24
4: 488
950450343_950450350 17 Left 950450343 3:13061680-13061702 CCCTGGGCCTCTGCACACTACTG 0: 1
1: 0
2: 2
3: 17
4: 239
Right 950450350 3:13061720-13061742 CAGACTTGCCCCAAACTGCCAGG 0: 1
1: 0
2: 2
3: 24
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950450350 Original CRISPR CAGACTTGCCCCAAACTGCC AGG Intronic
901101088 1:6719513-6719535 CAGACTTGTCTCAAACTCCTGGG - Intergenic
901106495 1:6760380-6760402 CAGACTGGTCCCAAACTCCTGGG - Intergenic
901200110 1:7462056-7462078 CACACTTGTCCCAACCTGACAGG + Intronic
901359412 1:8683797-8683819 CAGGCATGCCCCACCCTGCCCGG - Intronic
903409201 1:23126405-23126427 CAGGCTGGCCCCAAACTCCTGGG - Intronic
903963027 1:27069136-27069158 CAGCCTGGTCTCAAACTGCCAGG - Intergenic
904303837 1:29574151-29574173 CAAACTTGCCCCAAATGCCCTGG - Intergenic
904632533 1:31853370-31853392 CAGACTTGCACCACCATGCCTGG - Intergenic
904724264 1:32534938-32534960 CAGGCTTGTCCCAAACTCCTGGG - Intronic
905735897 1:40325600-40325622 CAGGCATGCCCCACCCTGCCTGG + Intergenic
907125594 1:52047690-52047712 CAGACTGGCCTCAAACTCCGGGG - Intronic
907204235 1:52754590-52754612 CAGACTGGTCTCAAACTGCTGGG + Intronic
907358324 1:53894477-53894499 GGGTCTGGCCCCAAACTGCCCGG + Exonic
909000356 1:70210365-70210387 CAGACTGGTCTCAAACTCCCAGG + Intronic
911431525 1:97794146-97794168 CAGACTAGCCTCAAACTCCTGGG + Intronic
913026447 1:114847024-114847046 CAGACTTGTCTCAAACTCCTGGG - Intergenic
914227924 1:145737051-145737073 CAGACTGGCCTCAAACTCCTAGG - Intronic
914988854 1:152481206-152481228 CAGAATTGTCCCAGACTCCCAGG + Intergenic
915459892 1:156063703-156063725 AGGACTTGCCCCAAGCTGCAGGG - Intronic
915502834 1:156331276-156331298 CAGGCTTGCCTCAAACTCCTGGG - Intronic
915931046 1:160061256-160061278 CAGACTTGCCACCAGCTGCCTGG + Intronic
916548885 1:165830821-165830843 CAGGCTGGCCTCAAACTCCCGGG - Intronic
916559886 1:165925604-165925626 CAGATTTGTCCGAAACTGCCTGG - Intergenic
916686672 1:167153465-167153487 CAGGCTGGCCTCAAACTCCCGGG + Intergenic
917394877 1:174582528-174582550 CAGACTAGCCTCAAACTCCAGGG - Intronic
917468323 1:175304318-175304340 CAGGCTGGCCTCAAACTCCCGGG + Intergenic
917967206 1:180186361-180186383 CACACCAGCCCCACACTGCCAGG + Intronic
918036974 1:180883174-180883196 CAGACTGGTCTCAAACTGCCGGG + Intronic
918291551 1:183113098-183113120 CAGACTGGTCTCAAACTCCCAGG - Intronic
918331561 1:183466038-183466060 CAGGCTGGCCCCAAACTCCTTGG + Intergenic
919304597 1:195815756-195815778 CAGACTGGTCTCAAACTCCCGGG - Intergenic
919950007 1:202354424-202354446 CAGACATGCACCAACATGCCTGG - Intronic
921384208 1:214552474-214552496 CAGAATCGCCCCACCCTGCCTGG + Intergenic
921502137 1:215917731-215917753 CAGACTCGTCTCAAACTCCCGGG - Intronic
921841826 1:219836476-219836498 CAGACATGCGCCACCCTGCCTGG + Intronic
922223668 1:223627410-223627432 CAGAGTTGGCCCCAGCTGCCTGG + Intronic
922978952 1:229808850-229808872 CAGGCTGGCCTCAAACTGCTGGG + Intergenic
924699735 1:246439170-246439192 CAGGCTGGCCCCAAACTCCTGGG + Intronic
1063023383 10:2153441-2153463 CAGGCTGGCCTCAAACTCCCCGG - Intergenic
1063554749 10:7067668-7067690 CAGACTGGTCCCAAACTCCCAGG + Intergenic
1064207086 10:13333581-13333603 CAGGCTTGCCCCACCATGCCTGG + Intronic
1064379546 10:14828793-14828815 CAGACTGGCTCCAAACTCCTGGG - Intronic
1064420218 10:15184608-15184630 CAGGCTTGCCCCAGTGTGCCTGG + Intergenic
1064461388 10:15537905-15537927 CAGGCTTGTCTCAAACTGCTGGG - Intronic
1064630720 10:17308183-17308205 CAGACTTGCACCACCATGCCGGG + Intergenic
1065139906 10:22710292-22710314 GAGACCTGCCTGAAACTGCCTGG + Intronic
1065513103 10:26499051-26499073 CAGACTTGTCTCAAACTCCTGGG - Intronic
1065551628 10:26873515-26873537 CAGGCTTGCCCCACCATGCCTGG + Intergenic
1067770891 10:49124082-49124104 CAGGCTTGTCTCAAACTGCTAGG + Intergenic
1067914270 10:50379833-50379855 GGGACCTGCCCCAAACTTCCTGG + Intronic
1067936453 10:50616344-50616366 CAGACTGGCCTCAAACTTCTGGG + Intronic
1068291344 10:55005159-55005181 CAGACTTGTCTCAAACTTCTGGG - Intronic
1068684777 10:59858902-59858924 CAGACTTGACTCACACTGCCTGG + Intronic
1069032487 10:63612380-63612402 CAGACTGGCCTCAAACTCCTGGG + Intronic
1069306135 10:66972364-66972386 CAGGCTTGCCTCAAACTACTGGG + Intronic
1069447646 10:68488191-68488213 CAGACTGGCCTCAAACTCCTGGG + Intronic
1071440845 10:85692449-85692471 CAGACTGGCCTCAAACTCCTGGG - Intronic
1075792005 10:125091560-125091582 CAGACTGGTCTCAAACTCCCGGG - Intronic
1076784152 10:132741088-132741110 CAGGCGTGCCCCACAATGCCTGG - Intronic
1076795278 10:132795187-132795209 CAGACCTGCCTCCAACTCCCAGG - Intergenic
1077856750 11:6134047-6134069 CAGACTGACCTCAAACTCCCTGG - Intergenic
1078776720 11:14400717-14400739 CAGGCATGCGCCAAAATGCCTGG - Intergenic
1080361029 11:31514246-31514268 CAGGCTTGTCTCAAACTCCCAGG - Intronic
1080963511 11:37187504-37187526 CAGACTAGCCTCAAACTCCTGGG - Intergenic
1081765508 11:45607419-45607441 CAGACTGGTCTCAAACTCCCAGG + Intergenic
1082015679 11:47484819-47484841 CAGGCATGCGCCAAAATGCCTGG + Intronic
1082863430 11:57876505-57876527 CAGACTGGCCTCAAACTCCTGGG + Intergenic
1083599431 11:63937777-63937799 CAGACTGGTCCCAAACTCCTGGG - Intergenic
1084015060 11:66373518-66373540 CAGACTTGCCATAACCAGCCTGG - Intergenic
1084105605 11:66978318-66978340 CAGACATGACCCACAGTGCCTGG + Intergenic
1084672285 11:70614452-70614474 CAGGCGTGCCCCAACATGCCTGG + Intronic
1084913997 11:72414136-72414158 CAGCCTTGGCACACACTGCCTGG - Intronic
1085353172 11:75814085-75814107 CAGACTAGTCTCAAACTCCCAGG - Intergenic
1085912302 11:80842225-80842247 CAGATATGCCCCAACATGCCTGG + Intergenic
1087093078 11:94295143-94295165 CGGACTGGTCTCAAACTGCCAGG - Intergenic
1088631236 11:111775662-111775684 CAGGCTGGCCTCAAACTCCCGGG - Intergenic
1088633108 11:111793190-111793212 CAGACTAGTCTCAAACTCCCGGG + Intronic
1088765471 11:112971584-112971606 CAGACTGGCCTCAAACTCCTGGG + Intronic
1088882758 11:113984403-113984425 CAGACTGGCCTCAAACTCCTGGG - Intronic
1089479858 11:118795706-118795728 CACATTTTCCCCAAACTGCCAGG + Intergenic
1089571348 11:119412802-119412824 CAGGCTTGCCTCAAACTCCTGGG + Intergenic
1090264975 11:125348086-125348108 CAGGCTTCCCCCAAAGGGCCAGG + Intronic
1090267024 11:125359677-125359699 CTGGCTTGCCCCAAACTGGAGGG + Intronic
1090811217 11:130245543-130245565 AAGGCTTGCCCCAAAACGCCTGG + Intronic
1090822023 11:130351182-130351204 CAGACTGGCCTCTAACTGCTAGG - Intergenic
1090981937 11:131730502-131730524 CAGGCTGGTCCCAAACTCCCGGG - Intronic
1091343684 11:134838798-134838820 CAGACTTTCCACAAAATCCCAGG + Intergenic
1092480051 12:8851614-8851636 CAGGCTGGCCTCAAACTGCTGGG + Intronic
1093557233 12:20490892-20490914 CAGACTGGTCTCAAACTCCCCGG - Intronic
1095190654 12:39254601-39254623 CAGACTTGTCTCAAACTCCTGGG - Intergenic
1095796691 12:46226834-46226856 CAGGCTGGTCTCAAACTGCCAGG + Intronic
1095988115 12:48014077-48014099 TAGACTGGCCTCAAACTGCTGGG + Intergenic
1096381218 12:51159696-51159718 CAGGCTGGCCTCAAACTCCCAGG + Intronic
1096757979 12:53815995-53816017 CAGGCTGGTCTCAAACTGCCGGG + Intergenic
1096798816 12:54095916-54095938 CAGACAGGCCCCATGCTGCCTGG + Intergenic
1097640740 12:62178155-62178177 CAGACTTGCACCACCATGCCTGG - Intronic
1097742751 12:63263377-63263399 CAGGCATGCACCAAAATGCCTGG - Intergenic
1098687463 12:73442136-73442158 CAGACTTGTCTCAAACTTCTGGG - Intergenic
1098955308 12:76683411-76683433 CAGTCAGGCCCCAAACTGACAGG - Intergenic
1098970549 12:76850439-76850461 CAGACATGCACCAACATGCCTGG - Intronic
1099559168 12:84150466-84150488 CAGACTTGTCTCAAACTCCTGGG + Intergenic
1100572188 12:95853163-95853185 CAGGCATGCACCACACTGCCTGG + Intergenic
1101762706 12:107671988-107672010 CAGGCTTGTCCCAAACTCCTGGG - Intergenic
1101948467 12:109156080-109156102 CAGGCTTGCACCACCCTGCCTGG - Intronic
1102595846 12:113992120-113992142 CAAAGTTGCCCCCAAATGCCAGG + Intergenic
1102881529 12:116488757-116488779 CAGACTTGTCCCAAACTCCTGGG - Intergenic
1102891689 12:116563953-116563975 CAGGCTGGCCCCAAACTCCTGGG + Intergenic
1102914352 12:116741859-116741881 CAGACTGGCCTCAAACTCCTGGG + Intronic
1103199825 12:119078707-119078729 CAGGCTTGCCTCAAACTTCTGGG - Intronic
1103984221 12:124756349-124756371 CAGACTGGTCTCAAACTGCTGGG + Intergenic
1105348243 13:19593206-19593228 CAGACTGGTCTCAAACTGCTGGG - Intergenic
1105368754 13:19784658-19784680 CAGGCTTGCACCAACATGCCTGG - Intergenic
1105504024 13:20994682-20994704 CAGTCTGGCCTCAAACTCCCGGG - Intronic
1105538029 13:21288025-21288047 CAGACTGGCCTCAAACTCCTGGG - Intergenic
1105827896 13:24138800-24138822 CAGGCTGGCCTCAAACTGCTGGG + Intronic
1106438970 13:29748634-29748656 CAGGCTGGTCCCAAACTGCTGGG + Intergenic
1107475809 13:40734688-40734710 CAGGCTGGCCTCAAACTGCTGGG - Intronic
1107637245 13:42405078-42405100 CAGGCTTGCCTCGAACTGCTGGG + Intergenic
1108335264 13:49434643-49434665 CAGGCTGGTCCCAAACTCCCAGG - Intronic
1108646475 13:52434499-52434521 CAGGCGTGCACCAACCTGCCTGG + Intronic
1109130445 13:58578045-58578067 CAGGCTGGCCCCAAACTCCTGGG + Intergenic
1109604788 13:64678623-64678645 CAGACTTTCACCTAAGTGCCTGG + Intergenic
1110018954 13:70444316-70444338 CAGGCTTGTCCCAAACTCCTGGG + Intergenic
1110053426 13:70934520-70934542 CAGACTTGTCACAGACTACCTGG - Intergenic
1111272346 13:85903057-85903079 CAGACCTGCACCAACATGCCTGG - Intergenic
1111618888 13:90697878-90697900 CAGGCTGGTCCCAAACTCCCGGG - Intergenic
1111698958 13:91661705-91661727 CAGACTTTCCCCCAACTCTCAGG - Intronic
1112162539 13:96884005-96884027 TAGAGTTGTCCCAAAGTGCCTGG + Intergenic
1112381884 13:98899182-98899204 AGGCCTTGCCCCAAACTTCCTGG + Intronic
1112842509 13:103598634-103598656 CAGACTAGCCCCAAACTTCCTGG + Intergenic
1113826219 13:113256109-113256131 CAGGCTGGCCTCAAACTCCCGGG - Intronic
1114496085 14:23133225-23133247 CAGACTGGCCTCAAACTTCCGGG - Intronic
1115556704 14:34549890-34549912 CAGATTGGCCTCAAACTCCCGGG - Intergenic
1116606433 14:47002584-47002606 CAGACATGCACCACAATGCCTGG - Intronic
1117425000 14:55584920-55584942 CAGGCTGGTCCCAAACTGCTGGG - Intronic
1117586441 14:57212073-57212095 CAGGCTGGTCCCAAACTCCCGGG + Intronic
1118211569 14:63770587-63770609 CAGGCTGGTCCCAAACTCCCTGG - Intergenic
1118226376 14:63903537-63903559 CAGGCTTGCCTCAAACTTCTGGG + Intronic
1118624307 14:67643611-67643633 CAGACTGGCCTCAAACTCCTGGG - Intronic
1119395690 14:74324675-74324697 CAGGCTGGCCTCAAACTACCGGG - Intronic
1120713621 14:87817820-87817842 CAGGCTGGCCTCAAACTCCCGGG - Intergenic
1120768697 14:88355796-88355818 CAGTCTGGTCTCAAACTGCCGGG + Intergenic
1120851117 14:89172294-89172316 CAGGCTGGCCTCAAACTCCCGGG + Intronic
1121316825 14:92966200-92966222 CAGACTTGTCTCAAACTCCTTGG + Intronic
1122020188 14:98831546-98831568 CAGACTTGGCCATACCTGCCAGG - Intergenic
1122054201 14:99081517-99081539 CAGCGTGGCCCCAAAATGCCTGG - Intergenic
1122193539 14:100067530-100067552 CAGGCTGGCCTCAAACTCCCGGG + Intronic
1122622478 14:103067661-103067683 CAGGCTGGTCCCAAACTCCCAGG + Intergenic
1122667997 14:103347211-103347233 CAGTCTTGTCCCACACTGCAGGG - Intergenic
1122766620 14:104076250-104076272 CAGACTGGTCTCAAACTCCCAGG - Intergenic
1122811868 14:104293258-104293280 CACTCTTACCCCAGACTGCCTGG + Intergenic
1124422505 15:29535105-29535127 CAGGCTTGCCCCACCATGCCCGG - Intronic
1125184002 15:36909990-36910012 CAGGCTGGCCTCAAACTGCGCGG - Intronic
1125327223 15:38548350-38548372 CAGGCTGGCCCCAAACTCCTGGG - Intronic
1125810732 15:42538968-42538990 CAGGCTGGCCCCAAACTCCTGGG - Exonic
1125838196 15:42772734-42772756 CAGACTGGGCTCAAACTGCTGGG - Intronic
1127024567 15:54789454-54789476 CAGGCTTGCCTCAGACTTCCAGG + Intergenic
1127411631 15:58713314-58713336 CAGACTGGTCTCAAACTGCTGGG + Intronic
1128967880 15:72078601-72078623 CAGGCTGGCCCCAAACTCCTGGG - Intronic
1129813427 15:78530044-78530066 CAGACTGGCCTCAAACTCCTGGG + Intronic
1129870874 15:78940371-78940393 CAGACTGGTCCCAAACTCCTAGG - Intronic
1130289120 15:82581184-82581206 CAGGCTGGCCCCAAACTCCTGGG + Intronic
1130413231 15:83664903-83664925 CAGGGTAGCCACAAACTGCCTGG - Intronic
1130614083 15:85387533-85387555 CAGGCTGGCCTCAAACTCCCGGG + Intronic
1131134469 15:89923032-89923054 CAGACTTGTCTCAAACTCCTGGG - Intergenic
1132534510 16:471404-471426 CAGACTTCCCCCAAGCTCCTGGG - Intronic
1132686890 16:1165918-1165940 CACTCTTGCCCCACACGGCCGGG - Intronic
1132709956 16:1262063-1262085 CAGGCTGGCCTCAAACTCCCCGG + Intergenic
1133227778 16:4350731-4350753 CAGACCTGCGCCACACTGTCAGG - Intronic
1133243232 16:4428826-4428848 CAGGCTGGTCCCAAACTGCTAGG - Intronic
1133378037 16:5305845-5305867 CAGACTGGTCCCAAACTCCTAGG - Intergenic
1133970394 16:10563714-10563736 CAGACTTGAGCCAGACTGACTGG + Intronic
1134261967 16:12658472-12658494 CAGGCTGGCCTCAAACTGCTGGG - Intergenic
1134538039 16:15042326-15042348 CAGACTTGCGCCACCATGCCTGG + Intronic
1135700083 16:24624692-24624714 CAGGCTGGCCTCAAACTTCCGGG + Intergenic
1136083208 16:27866712-27866734 CAGACTTGCACCACCATGCCAGG + Intronic
1137231899 16:46574268-46574290 CAGACTTGCACCATGATGCCTGG - Intergenic
1138311355 16:56026192-56026214 CAGGCTGGCCCCAACCTTCCAGG + Intergenic
1138377742 16:56577635-56577657 CAGACTGGTCTCAAACTCCCTGG - Intergenic
1138502242 16:57454443-57454465 CAGACTGGTCCCAAACTGCTGGG - Intronic
1138571690 16:57878163-57878185 CAGGCTGGCCTCAAACTGCTGGG + Intergenic
1139077582 16:63471610-63471632 AAGTCTTCCCTCAAACTGCCTGG - Intergenic
1139418507 16:66833331-66833353 CAGACTTGTCTCAAACTCCTGGG + Intronic
1139425860 16:66879734-66879756 CAGGCTGGTCTCAAACTGCCGGG - Intronic
1139434680 16:66929215-66929237 CAGGCTTGCCTCAAAATGCTGGG + Intergenic
1140208656 16:72953782-72953804 CAGACTGGTCTCAAACTCCCAGG + Intronic
1140314356 16:73880191-73880213 CAGATTTGCCCCAAAAAGCAAGG + Intergenic
1140488248 16:75311813-75311835 CAGACTGGCCCCGAACTCCTGGG + Intronic
1141346919 16:83255280-83255302 GAGAGATGCCCCAAACTGCCGGG + Intronic
1141515659 16:84543158-84543180 CAGGCTTGTCTCAAACTCCCGGG + Intronic
1141985620 16:87577755-87577777 CAGACTGGCCTCAAACTCCTGGG - Intergenic
1141993032 16:87621235-87621257 CCGACTTGGCCCAGAGTGCCAGG + Intronic
1143079670 17:4372100-4372122 CAGACTGGCCTCAAACTCCTGGG - Intergenic
1143966059 17:10757167-10757189 CAGCCTGGCCCCAGGCTGCCGGG - Intergenic
1148345545 17:46901302-46901324 CAGACTTGCACCATCATGCCCGG + Intergenic
1148403491 17:47388318-47388340 CACCCCTCCCCCAAACTGCCAGG - Intronic
1148790668 17:50170847-50170869 CAGGCTGGCCTCAAACTTCCAGG - Intronic
1148884213 17:50759787-50759809 CAGGCATGCTCCAAAATGCCTGG - Intergenic
1148916166 17:50980785-50980807 CAGACTGGCCTCAAACTCCTGGG - Intronic
1149540435 17:57464230-57464252 CAGGCTGGCCCCAAACTCCTGGG - Intronic
1149674611 17:58447936-58447958 CAGACTGGCCTCAAACTCCTGGG - Intronic
1149892675 17:60403895-60403917 CAGGCGTGTGCCAAACTGCCTGG - Intronic
1149910883 17:60565812-60565834 CAGACACGCACCAAAATGCCTGG + Intronic
1150116588 17:62556055-62556077 CAGGCATGCCCCACAATGCCTGG + Intronic
1150262010 17:63801427-63801449 CAGACTGGCCCCAAATCCCCTGG + Intronic
1150601324 17:66653381-66653403 CAGACTTGTCTCAAACTCCTGGG - Intronic
1150881446 17:69033162-69033184 CAGACATGCCCCACCATGCCTGG - Intronic
1151601083 17:75106540-75106562 CAGGCTGGCCTCAAACTCCCAGG - Intergenic
1152265752 17:79293593-79293615 CAGACTTGCACCACCATGCCTGG + Intronic
1153628757 18:7048460-7048482 CAGGCTGGTCCCAAACTCCCAGG + Intronic
1153777438 18:8466430-8466452 CAGACCAGCCCCACACTCCCTGG + Intergenic
1155334654 18:24751511-24751533 CAGAGTTTCCCCTAAGTGCCTGG - Intergenic
1155647263 18:28094343-28094365 CAGACTTGCACCACCATGCCTGG - Intronic
1155712293 18:28897668-28897690 CAGGCATGCACCAAAATGCCTGG - Intergenic
1155744046 18:29328386-29328408 CAGACTGGCCTCAAACTCCTAGG - Intergenic
1155824863 18:30428179-30428201 CAGACATGCACCAACATGCCCGG - Intergenic
1156295748 18:35789145-35789167 CAGGCTAGTCCCAAACTTCCAGG + Intergenic
1157837383 18:50918428-50918450 CAGACTTCCCTCAAAATGTCAGG - Intronic
1158592313 18:58788281-58788303 CAGGCTGGCCTCAAACTGCTGGG + Intergenic
1158719797 18:59914738-59914760 CAGACTGGCCTCAAACTCCTGGG - Intergenic
1160992217 19:1864432-1864454 CAGCCTTGCCCCACCCTCCCGGG - Intergenic
1161160119 19:2757145-2757167 CAGAGATGCCCCCACCTGCCTGG + Intronic
1162699572 19:12503839-12503861 CAGACTGGTCTCAAACTCCCGGG - Intronic
1162885953 19:13697263-13697285 CAGACTAGTCTCAAACTGCTGGG - Intergenic
1162976776 19:14211045-14211067 CAGACTGGTCTCAAACTCCCGGG + Intergenic
1163546382 19:17943449-17943471 CAGCCTTGCCCCGAAAAGCCCGG - Intronic
1163613669 19:18313724-18313746 CAGACTGGTCCCAAACTCCTGGG + Intronic
1163763759 19:19151040-19151062 CAGGCTGGCCTCAAACTCCCAGG - Intronic
1163937616 19:20463455-20463477 CAGACTTGAGCCATCCTGCCTGG + Intergenic
1164523932 19:28999970-28999992 CAGACATGGCCCACACAGCCAGG + Intergenic
1164628268 19:29743831-29743853 CAGACTTGTCTCAAACTCCTGGG - Intergenic
1164669711 19:30065478-30065500 GAGGCTTGCCCCAACCTTCCTGG - Intergenic
1164762323 19:30737334-30737356 CAGACTTCAACCAAAATGCCTGG + Intergenic
1164865646 19:31602255-31602277 CATACTTGCCCCAGCCTGCATGG + Intergenic
1165165006 19:33846876-33846898 CAGGCTTGTCTCAAACTGCTTGG - Intergenic
1165526597 19:36360838-36360860 CAGACTGGATCCAGACTGCCTGG + Intronic
1165803952 19:38568957-38568979 CTGGCTTGCCCCAAACTCCTGGG - Intronic
1165955615 19:39500215-39500237 GAGACTGGTCTCAAACTGCCGGG - Intronic
1166062838 19:40337434-40337456 CAAACTGACCCCAACCTGCCAGG + Intronic
1166407618 19:42532393-42532415 CAGACATGCACCAACATGCCCGG + Intronic
1166539237 19:43594702-43594724 AAGCCTTGCCCCAAACTCACTGG + Intronic
1166643666 19:44515113-44515135 CAGACTTGAGCCACAGTGCCCGG + Intronic
1166672731 19:44721242-44721264 CAGGCTTGCACCACAATGCCTGG - Intergenic
1166684497 19:44788005-44788027 CAGGCTGGCCTCAAACTGCTGGG + Intronic
1166729054 19:45047940-45047962 CAGGCATGCACCAACCTGCCTGG - Intronic
1166729117 19:45048391-45048413 CAGGCATGCACCAAAATGCCTGG - Intronic
1166754228 19:45180466-45180488 CAGGCTTGTCTCAAACTCCCGGG + Exonic
1166974550 19:46597596-46597618 CAGACTGGCCTCAAACTCCTAGG + Intronic
927062653 2:19438951-19438973 CAGACCTGGACCTAACTGCCTGG + Intergenic
927170214 2:20363019-20363041 CAGGCTGGCCCCAAACTTCTGGG - Intergenic
929022538 2:37567824-37567846 CAGACTAGTCTCAAACTTCCAGG - Intergenic
929023191 2:37574611-37574633 CAGACTAGTCTCAAACTCCCAGG - Intergenic
929196843 2:39193516-39193538 CAGACATGCGCCAACATGCCCGG + Intronic
929759003 2:44790730-44790752 CAGACTCCCCCCAAAGGGCCAGG - Intergenic
929853892 2:45619371-45619393 CAGACTGGCCTCAAACTCCTGGG + Intergenic
930969619 2:57379012-57379034 CAGGCTTGTCTCAAACTCCCAGG - Intergenic
931697867 2:64885209-64885231 CAGACTGGCCTCAAACTCCTGGG + Intergenic
933075624 2:77922108-77922130 CAGACATGCACCACAATGCCTGG + Intergenic
933974903 2:87501266-87501288 CAGTGTTGCTGCAAACTGCCGGG - Intergenic
934103267 2:88673172-88673194 CAGACTGGCCTCAAACTCCTGGG - Intergenic
934541228 2:95176617-95176639 CAGCCTAGCCCCACACTCCCTGG - Intronic
934907912 2:98221831-98221853 TAGACTGGCCTCACACTGCCTGG - Intronic
934927837 2:98394058-98394080 TAGACTTGCCCCCAACTTCCGGG + Intronic
935989336 2:108705328-108705350 CAGACATGTCCCACAATGCCTGG + Intergenic
936318924 2:111449547-111449569 CAGTGTTGCTGCAAACTGCCGGG + Intergenic
939389296 2:141545632-141545654 CAGGCTTGTCTCAAACTGCTGGG - Intronic
940541657 2:155027999-155028021 CAGGCTGGCCCCAAACTCCTGGG + Intergenic
940560985 2:155296475-155296497 CAGACTGGCCTCAAATTCCCGGG - Intergenic
940633429 2:156266842-156266864 CAGACTTGTCTCAAACTCCCGGG + Intergenic
941993953 2:171583747-171583769 CAGGCTTGCCTCAAACTCCTGGG + Intergenic
942918042 2:181336281-181336303 CAGGCTAGTCTCAAACTGCCGGG + Intergenic
943671994 2:190672763-190672785 CAGACTAGCCACAAACTCCTAGG - Intronic
944066223 2:195622153-195622175 CAGACTGGTCTCAAACTGCTGGG - Intronic
944240378 2:197480268-197480290 CAGACATGCACCACTCTGCCTGG - Intergenic
945085091 2:206122943-206122965 CAGACTGGTCTCCAACTGCCTGG + Intronic
946389278 2:219405633-219405655 CAGACTGCCCCCAACCGGCCTGG - Intergenic
946917399 2:224538954-224538976 CAGGCTTGCCTCAAACTCCTGGG - Intronic
948097531 2:235348354-235348376 CTGACCTGCTCCAAATTGCCAGG - Intergenic
948416677 2:237811477-237811499 CAGGCTGGTCCCAAACTTCCTGG + Intronic
1170729061 20:18956446-18956468 CAGGCTAGCCTCAAACTCCCGGG - Intergenic
1170898099 20:20434723-20434745 CAGACTGGCCTCAAACTCCTGGG - Intronic
1172032230 20:31990239-31990261 CAGACTGGTCTCAAACTCCCCGG + Intronic
1172131401 20:32658501-32658523 CAGGCTGGCCCCAAACTCCTGGG + Intergenic
1172148791 20:32776084-32776106 CAGACTTGCACCACCATGCCTGG - Intronic
1172270172 20:33650575-33650597 CAGGCTGGCCTCAAACTCCCGGG + Intergenic
1172449165 20:35009729-35009751 GAGACTAGCCCCCCACTGCCTGG + Intronic
1172569717 20:35960561-35960583 CAGGCTGGCCTCAAACTGCTGGG + Intronic
1173077092 20:39829456-39829478 CAGCCTTGCAGCAAAATGCCTGG + Intergenic
1173120850 20:40287493-40287515 CAGGCTTGCGCCAAGTTGCCCGG - Intergenic
1173348024 20:42218801-42218823 AAGACTTGTCCCACACAGCCGGG - Intronic
1173572366 20:44085709-44085731 CAGACTTGTCTCAAACTCCAGGG + Intergenic
1175309329 20:58000525-58000547 CAGCCTTGAGCCAGACTGCCTGG + Intergenic
1175364004 20:58438487-58438509 CAGACTGGTCTCAAACTGCTGGG + Intronic
1175830775 20:61964632-61964654 CAGACTGGTCTCAAACTGCCAGG + Intronic
1176210443 20:63918303-63918325 CAGGCTGGCCTCAAACTCCCAGG - Intronic
1177507455 21:22037130-22037152 CAGACTGGCCTCAAACTCCTAGG + Intergenic
1178390127 21:32191447-32191469 CAGGCTTGCACCACAATGCCTGG - Intergenic
1179680203 21:43014657-43014679 CAGGCTTGTCCCAAACTCCTGGG + Intronic
1180666008 22:17512743-17512765 CAAACTTGCCACAAACTCTCAGG - Intronic
1180757782 22:18174804-18174826 CAGGCTTGTCTCAAACTGCTGGG + Intronic
1180788969 22:18563552-18563574 CAGACTGGCCTCAAACTCCTGGG + Intergenic
1181232767 22:21431768-21431790 CAGACTGGCCTCAAACTCCTGGG - Intronic
1181245884 22:21503088-21503110 CAGACTGGCCTCAAACTCCTGGG + Intergenic
1181471992 22:23146097-23146119 CAGGCCTGCCCCACCCTGCCTGG - Intronic
1181701768 22:24625474-24625496 CAGACTGGTCTCAAACTCCCGGG + Intronic
1182921394 22:34083244-34083266 GGTACTAGCCCCAAACTGCCTGG + Intergenic
1183431922 22:37771192-37771214 CAGACTGGAGCCAGACTGCCTGG - Intronic
1184063293 22:42098926-42098948 CAGGCTGGCCCCAAACTCCTGGG + Intergenic
949529551 3:4940823-4940845 CAGACTGGCCTCAAACTCCTGGG - Intergenic
949998355 3:9637027-9637049 CAGACATGCACCACAATGCCTGG + Intergenic
950137649 3:10592994-10593016 CAGACTTGTCCCAAACTTCTGGG + Intronic
950431318 3:12952755-12952777 CGGACTTCCCCCAGGCTGCCTGG + Intronic
950450350 3:13061720-13061742 CAGACTTGCCCCAAACTGCCAGG + Intronic
950506957 3:13400932-13400954 GAGACTTGTCAGAAACTGCCTGG + Intronic
953212530 3:40888786-40888808 CAGACTTGTCTCAAACTCCTGGG + Intergenic
954219159 3:49142228-49142250 CAGTCTTGCCCCAGAGTGCGGGG + Intergenic
955197846 3:56821819-56821841 CAGGCTTGCCCCACCATGCCCGG - Intronic
955319890 3:57966782-57966804 CAGGCTGGTCTCAAACTGCCAGG - Intergenic
959473241 3:106778872-106778894 CAGACATGCCCCACCATGCCTGG + Intergenic
959930920 3:111981091-111981113 CAGACTGGTCTCAAACTCCCAGG - Intronic
960100889 3:113742402-113742424 CAGACTTGCACCAGCATGCCTGG + Intronic
961018993 3:123488215-123488237 CAGGCTGGCCCCAAACTCCTGGG - Intergenic
961858955 3:129898881-129898903 CAGGCTTGTCCCAAACTCCTGGG - Intergenic
962565993 3:136660756-136660778 CAGACTGGTCTCAAACTGCTGGG - Intronic
962979509 3:140474890-140474912 CAGAATTGCTCCTAACTTCCAGG - Intronic
963800686 3:149673163-149673185 CAGACTGGCCTCAAACTCCTGGG - Intronic
964750338 3:160048520-160048542 CAGACTGGTCTCAAACTCCCAGG + Intergenic
965547534 3:169931528-169931550 CAGACTTGTCTCAAACTCCTGGG + Intronic
966188639 3:177250620-177250642 CAGACTGGCCTCAAACTTCTGGG - Intergenic
966300678 3:178476171-178476193 CAGGCTTGGCCCAACCTTCCTGG + Intronic
967388513 3:188932819-188932841 CAGGCTTGCGCCAACATGCCCGG + Intergenic
968328036 3:197838207-197838229 CAGGCCGGCCTCAAACTGCCGGG - Intronic
968732780 4:2278328-2278350 CAGGCGTGCACCACACTGCCCGG + Intronic
969084802 4:4648232-4648254 CAGGCATGCCCCAACATGCCTGG + Intergenic
969954853 4:10878568-10878590 CAGACATGCACCACAATGCCTGG + Intergenic
970227846 4:13878498-13878520 CTGACTTGCCTCAGACTGACAGG + Intergenic
970316329 4:14831716-14831738 GAGACTTGCCAGAAGCTGCCAGG + Intergenic
970503987 4:16708269-16708291 CATACTGGCCTCAAACTGCTGGG - Intronic
970517138 4:16844040-16844062 CAGACTGGTCTCAAACTGCTGGG - Intronic
972074943 4:35075822-35075844 CAGGCTGGCCTCAAACTGCAGGG - Intergenic
972463150 4:39325591-39325613 CAGACTGGTCTCAAACTCCCAGG + Intronic
973072469 4:45881056-45881078 CAGCCTTTCCCCCAAGTGCCCGG + Intergenic
973779180 4:54272053-54272075 CAGGCTTGCCTCAAACTCCTGGG + Intronic
973953818 4:56042811-56042833 CAGACTGGCCTCAAACTCCTGGG + Intergenic
974517652 4:62937777-62937799 CATATTTGCCACAGACTGCCTGG - Intergenic
975641448 4:76504434-76504456 CAGGCGTGCGCCAAAATGCCCGG + Intronic
975734194 4:77365923-77365945 CAGGCATGCACCAAAATGCCTGG + Intronic
976403535 4:84635965-84635987 CAGGCTTGTCCCAAACTCCTAGG + Intronic
976584473 4:86779643-86779665 CTGACTAGCCCCAAAATGCAAGG - Intronic
977850541 4:101822142-101822164 CAGACTGGTCTCAAACTGCTGGG - Intronic
977934514 4:102785913-102785935 CAGGCTTGTCTCAAACTCCCAGG + Intergenic
979265794 4:118701394-118701416 CAGGCTGGCCCCAAACTCCTGGG + Intronic
979541110 4:121883779-121883801 CAGGCTTGCCTCAAACTCCTGGG + Intronic
981053403 4:140334127-140334149 CAGACTGGTCTCAAACTCCCAGG + Intronic
981086616 4:140689997-140690019 CAGACTTGAGCCACAGTGCCTGG + Intronic
981209209 4:142082166-142082188 CAGATTTGCCGCAAACTGAATGG - Exonic
981647978 4:147021225-147021247 CAGGCTGGCCTCAAACTGCTGGG + Intergenic
982272381 4:153604398-153604420 CAGACTTGCCAGAAATTTCCAGG + Exonic
983637273 4:169910659-169910681 CAGACTGGTCCCAAACTCCTGGG - Intergenic
983782795 4:171693466-171693488 CAGACTTGCCTCAATCTCCTGGG - Intergenic
983861020 4:172707100-172707122 CACCCCTCCCCCAAACTGCCAGG - Intronic
984142049 4:176015420-176015442 CAGGCATGCCCCAACATGCCCGG + Intergenic
984308619 4:178028110-178028132 CAGACAGGACCCACACTGCCAGG - Intergenic
984394944 4:179185611-179185633 CAGACATGAGCCACACTGCCTGG - Intergenic
984712459 4:182897091-182897113 AAATTTTGCCCCAAACTGCCTGG - Intronic
985681099 5:1256344-1256366 CACACCTGCCCCAAAGTCCCAGG - Intronic
986962309 5:13230030-13230052 CAGACATGCACCACAATGCCTGG - Intergenic
987958882 5:24777415-24777437 CAGGCATGCGCCAAAATGCCCGG - Intergenic
988552551 5:32209884-32209906 CAGACTGGTCTCAAACTCCCGGG + Intergenic
989987901 5:50724030-50724052 CAGGCTTGCCTCAAACTCCTGGG + Intronic
990273658 5:54172966-54172988 CAGACTGGTCCCAAAGTGCTGGG - Intronic
991311936 5:65253096-65253118 CAGGCTTGTCTCAAACTCCCGGG + Intronic
992790221 5:80206857-80206879 CAGACTGGCCTCAAACTCCTGGG + Intronic
993710706 5:91221854-91221876 CAGGCTGGCCTCAAACTGCTAGG - Intergenic
994967436 5:106692771-106692793 CAGACTGGCATCAAACTGCTGGG + Intergenic
996576012 5:124976936-124976958 CAGACTGGTCTCAAACTCCCAGG + Intergenic
996726423 5:126676597-126676619 CAGACTAGCCTCAAACTCCTGGG - Intergenic
996856686 5:128016120-128016142 CAGCTTTGCCCCACACTGCCTGG + Intergenic
997915224 5:137918005-137918027 CAGACTGGTCTCAAACTGCTGGG - Intronic
998063409 5:139137017-139137039 CAGCCATGCCTCAGACTGCCCGG + Intronic
998496668 5:142596257-142596279 CAGACTGGCCTCAAACTCCTGGG - Intronic
999105077 5:149063439-149063461 CTGACTTGGCCCACACTGACTGG + Intergenic
999171577 5:149599485-149599507 CAGACTGGTCTCAAACTCCCAGG + Intronic
999769384 5:154763793-154763815 CAGACTGGTCTCAAACTTCCAGG - Intronic
1000123849 5:158224471-158224493 CATAGTTTCCCCAAACTGCTGGG + Intergenic
1000307883 5:160012506-160012528 CAGGCTTGCACCACCCTGCCTGG + Intronic
1000428175 5:161116986-161117008 CAGGCTGGCCTCAAACTCCCAGG + Intergenic
1000597026 5:163227493-163227515 CAGGCATGCACCAACCTGCCTGG - Intergenic
1000996863 5:167968212-167968234 CAGAATGGCCCCAAATTGTCTGG - Intronic
1001650713 5:173314091-173314113 CAGACTTGTCCCAAACTGTGTGG - Intergenic
1001981760 5:176043199-176043221 CAGGCATGCCCCACAATGCCTGG + Intergenic
1002235705 5:177800861-177800883 CAGGCATGCCCCACAATGCCTGG - Intergenic
1002536204 5:179877172-179877194 CAGACTGGCCTCAAACTCCTAGG - Intronic
1003301307 6:4885202-4885224 CAGGCTGGCCTCAAACTGCTAGG + Intronic
1003681059 6:8257613-8257635 CAGGCTGGTCTCAAACTGCCGGG - Intergenic
1006137627 6:31905221-31905243 CAGACTGGTCTCAAACTGCTGGG - Intronic
1006235856 6:32631347-32631369 CAGGCTGGCCTCAAACTCCCAGG - Intronic
1006349039 6:33507379-33507401 CAGACTGGTCTCAAACTGCTGGG + Intergenic
1006753859 6:36397363-36397385 CAGACTGGCCTCAAACTCCTGGG - Intronic
1006766841 6:36513791-36513813 CAGGCTGGTCTCAAACTGCCTGG - Intronic
1007579352 6:42947207-42947229 CAGGCTGGTCCCAAACTGCTGGG - Intergenic
1008280105 6:49586500-49586522 CAGGCTTGTCCCAAACTCCTAGG + Intergenic
1012454258 6:99387236-99387258 CAGACTTGTCTCAAACTCCTGGG - Intronic
1013246703 6:108294155-108294177 CAGACTGGTCTCAAACTCCCGGG + Intergenic
1013267981 6:108518946-108518968 CAGACCAGCTCCAAACAGCCAGG + Intronic
1013516975 6:110897088-110897110 CAGACTGGCCTCAAACTCCTAGG - Intergenic
1014167584 6:118243401-118243423 CAGGCTTTCCCCAAACTCCTGGG - Intronic
1014769606 6:125445726-125445748 CAGCCATCCCCCAAAATGCCTGG - Intergenic
1015684442 6:135843944-135843966 CAGACTGGTCCCAAACTCCTGGG + Intergenic
1015993907 6:138978518-138978540 CAGACTGGTCTCAAACTCCCGGG + Intronic
1016277696 6:142373930-142373952 CAGACTGGCCTCAAACTCCTGGG + Intronic
1016700180 6:147045469-147045491 CAGACTGGCCTCAAACTCCTAGG + Intergenic
1016822982 6:148363350-148363372 CAGACTGGCCTCAAACTCCTGGG + Intronic
1016977957 6:149827495-149827517 TAGACTGTCCCCAAAGTGCCAGG - Intronic
1017692505 6:156980754-156980776 CAGCCTTTCCCCAGACTGCCGGG - Intronic
1018822110 6:167381727-167381749 CAGACTTGTCCCAAACTCCTGGG + Intronic
1019568914 7:1699425-1699447 CAGACTTGTTTCAAACTCCCGGG - Intronic
1020324889 7:6966801-6966823 CAGACTGGCCTCAAACTCCTGGG + Intergenic
1020414584 7:7931193-7931215 CAGACTGGCCTCAAACTCCTGGG + Intronic
1020662542 7:10999083-10999105 CAGGCTTGCCTCAAACTCCTGGG + Intronic
1021553211 7:21894029-21894051 CAGACATGCTCCAACATGCCTGG + Intronic
1022259984 7:28695012-28695034 CAGACTAGCCTCAAACTCTCGGG - Intronic
1022300010 7:29094196-29094218 CAGACTTGCGCCACCATGCCTGG - Intronic
1022425864 7:30268188-30268210 CAGACTGGTCCCAAACTCCTGGG + Intergenic
1022962676 7:35444643-35444665 CAGACTTGTCTCAAACTCCTGGG + Intergenic
1023237605 7:38106884-38106906 CAGACGTGCGCCACAATGCCTGG - Intergenic
1024726425 7:52201578-52201600 CAGGCTAGTCTCAAACTGCCTGG + Intergenic
1025197277 7:56942978-56943000 CAGGCTGGCCTCAAACTGCTGGG + Intergenic
1025674672 7:63633961-63633983 CAGGCTGGCCTCAAACTGCTGGG - Intergenic
1025706473 7:63869972-63869994 CAGGTTTGCCTCAAACTGCTGGG - Intergenic
1026161528 7:67873619-67873641 CAGGCTGGCCTCAAACTCCCGGG + Intergenic
1026904477 7:74055030-74055052 CAGAGGAGCCCAAAACTGCCTGG + Intronic
1030276145 7:107723825-107723847 CAGACTTGCCACACTATGCCGGG + Intergenic
1030458845 7:109806272-109806294 CAGACTGGCCTCAAACTCCTGGG - Intergenic
1032209580 7:129901278-129901300 CAGACTTGAACTAGACTGCCTGG - Intronic
1032675343 7:134125031-134125053 ATGACTTGCCCCAAATTGCCTGG - Intergenic
1032785006 7:135193792-135193814 CAGATTTCCCCTGAACTGCCTGG - Intronic
1032998624 7:137477869-137477891 CAGACTGGTCTCAAACTGCTGGG + Intronic
1033222978 7:139540841-139540863 CAGACTAGCCCCCAACTCCTGGG - Intronic
1034194105 7:149232888-149232910 CAGACTGGCCTCAAACTCCTGGG + Intergenic
1034521058 7:151620384-151620406 CAGACTGGCCTCAAACTCCTGGG + Intronic
1034735669 7:153427181-153427203 CAGAATTTCCCAAACCTGCCTGG + Intergenic
1036780697 8:11644998-11645020 CAGCCTTTTCCCACACTGCCTGG - Intergenic
1037786321 8:21905506-21905528 CAGACTGGTCTCAAACTGCTGGG + Intergenic
1038456212 8:27673395-27673417 CAGACCTGCCCCAAGGGGCCTGG + Intronic
1039586275 8:38709857-38709879 CAGACTGGTCCCAAACTCCTGGG + Intergenic
1039593188 8:38767852-38767874 CAGACTGGTCCCAAACTCCTGGG - Intronic
1039717592 8:40127104-40127126 CAGACTGGCCTCAAACTCCAGGG + Intergenic
1040012718 8:42675786-42675808 CAGGCTTGTCTCAAACTCCCAGG - Intergenic
1040457589 8:47614362-47614384 CAGACGTGCACCACAATGCCTGG + Intronic
1040944308 8:52867052-52867074 CAGACTGGTCCCAAACTCCTGGG - Intergenic
1041132234 8:54713475-54713497 CAGACATACCCCACACTGGCAGG + Intergenic
1041249701 8:55922298-55922320 CAGACTAGCCTCAAACTCCTGGG + Intronic
1041308567 8:56489781-56489803 AAGGCTGGCCTCAAACTGCCAGG - Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042124976 8:65529119-65529141 GAGACTTGCCCCAAACTCCTGGG - Intergenic
1043393429 8:79813178-79813200 CAGACTTGCGCCACCGTGCCTGG - Intergenic
1044784312 8:95778458-95778480 CAGACCTGCCACAGACTGCTGGG - Intergenic
1045338120 8:101226836-101226858 CAGACTTGAGCCACAGTGCCCGG - Intergenic
1045832731 8:106483484-106483506 CAGGCTTGCCTCAAACTTCTAGG - Intronic
1046128042 8:109935371-109935393 CAGGCTTGTCTCAAACTCCCAGG - Intergenic
1046427034 8:114067530-114067552 CAGACATGCCCCACAATGCCTGG + Intergenic
1047392543 8:124465141-124465163 CAGCCTTGCCACAGAATGCCAGG - Intergenic
1047511543 8:125519807-125519829 CACACCTGCCCCACACTGCCAGG + Intergenic
1048568431 8:135628705-135628727 CAGTCTTGCCAGAAACTTCCAGG + Intronic
1050613889 9:7381824-7381846 CAGACTTGCCCCATGCTGCTGGG + Intergenic
1050706995 9:8411956-8411978 TTTGCTTGCCCCAAACTGCCTGG - Intronic
1050913674 9:11105195-11105217 CAGGCTGGCCCCAAACTCCTGGG + Intergenic
1051234770 9:14987656-14987678 CAGACTGGCCTCAAACTTCTGGG - Intergenic
1052793217 9:32897603-32897625 CAGAAATGCCTCAAACTGGCTGG + Intergenic
1053376756 9:37613915-37613937 CACACTTGCCTCCTACTGCCTGG + Intronic
1053449208 9:38179282-38179304 CACACCTGCCCCAAACTCCTGGG - Intergenic
1053517293 9:38741656-38741678 CAGACTTTCCCCACACTGACAGG - Intergenic
1055051395 9:71984899-71984921 CAGAGCTGCCGCAACCTGCCTGG - Intronic
1055533682 9:77214131-77214153 CAGACGTGCCCCACCGTGCCTGG - Intronic
1056190813 9:84182177-84182199 CAGACTGGCCAGAAACTGCTGGG - Intergenic
1060099288 9:120824059-120824081 CAGGCTGGCCCCGAACTCCCGGG - Intronic
1060427150 9:123515854-123515876 CAGACTGGCCTCAAACTCCTGGG - Intronic
1060651446 9:125330459-125330481 CAGACATGCCCCACCATGCCGGG + Intronic
1061287060 9:129629887-129629909 CAGGCTGGCCCCAAACTCCTGGG - Intronic
1061741722 9:132711540-132711562 CAGAGTTTCACCATACTGCCAGG + Intergenic
1061827078 9:133265196-133265218 CAGACATGCACCAACATGCCCGG + Intronic
1185771890 X:2771129-2771151 CAGACGTGCCTCAACATGCCTGG + Intronic
1185817945 X:3173710-3173732 CAGGCTTGTCTCAAACTCCCAGG + Intergenic
1185907453 X:3949237-3949259 CAGACTGGTCTCAAACTCCCAGG + Intergenic
1186084945 X:5977430-5977452 CAGACTGGCCTCAAATTCCCAGG + Intronic
1186461537 X:9752276-9752298 CAGGCTTGTCTCAAACTCCCGGG + Intronic
1186532744 X:10313833-10313855 CAGGCTGGCCTCAAACTCCCGGG - Intergenic
1186977072 X:14919005-14919027 CAGACTGGCCTCAAACTCCTGGG - Intronic
1187418733 X:19116067-19116089 CAGGCTTGCCCCACCATGCCTGG - Intronic
1187797404 X:23019338-23019360 CAGGCTGGCCTCAAACTGGCTGG + Intergenic
1189108663 X:38264027-38264049 CAGACTGGTCTCAAACTGCTGGG + Intronic
1189298380 X:39935156-39935178 CAGACTGGTCTCAAACTCCCGGG + Intergenic
1189342399 X:40214141-40214163 CAGGCTGGCCTCAAACTCCCGGG + Intergenic
1189599217 X:42604151-42604173 CAGTCTTTGCCCAACCTGCCTGG - Intergenic
1190299101 X:49045831-49045853 CAGACTAGTCTCAAACTCCCGGG - Intergenic
1190724962 X:53183213-53183235 CAGACTGGCCTCAAACTCCTGGG - Intergenic
1190775837 X:53551650-53551672 CAGGCATGCACCAAAATGCCTGG + Intronic
1190789960 X:53689290-53689312 CAGCCTTGTCCCAAACTCCTGGG + Intergenic
1190811372 X:53887591-53887613 CAGACTGGTCTCAAACTCCCAGG - Intergenic
1190954190 X:55175495-55175517 CAGGCTGGCCTCAAACTCCCAGG - Intronic
1192066831 X:67893772-67893794 CAGACATGCACCACCCTGCCTGG + Intergenic
1192119565 X:68442178-68442200 CAGACTGGCCTCAAACTCCTGGG + Intergenic
1194053454 X:89101078-89101100 CAGTCTTGCCCCTAACTGCCTGG + Intergenic
1194534639 X:95091113-95091135 CAGACTGGTCTCAAACTCCCGGG - Intergenic
1195174650 X:102304083-102304105 CAGTCTAGCACCATACTGCCTGG + Intergenic
1195184215 X:102383010-102383032 CAGTCTAGCACCATACTGCCTGG - Intronic
1195267757 X:103199779-103199801 CAGACTTGTCTCAAACTCCTGGG + Intergenic
1195392287 X:104375157-104375179 CAGACTTGTCTCAAACTTCTGGG + Intergenic
1196098323 X:111823272-111823294 CAGACCTCCCCCATTCTGCCTGG - Intronic
1197210378 X:123823462-123823484 CACACCTGCCCCAAAGTGCGAGG - Intergenic
1197973918 X:132144805-132144827 CAGACTGGCCTCAAACTCCTGGG - Intergenic
1198828747 X:140726956-140726978 CAGACTTGCCCCACTCTGTATGG + Intergenic
1198940789 X:141952998-141953020 CAGACTTGCCCCACATCCCCAGG - Intergenic
1199682316 X:150235216-150235238 CAGACTGGTCTCAAACTCCCGGG - Intergenic