ID: 950451141

View in Genome Browser
Species Human (GRCh38)
Location 3:13066569-13066591
Sequence CCTGCCCAGCCCTGCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 762
Summary {0: 1, 1: 0, 2: 16, 3: 111, 4: 634}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950451141_950451149 5 Left 950451141 3:13066569-13066591 CCTTCCAGGCAGGGCTGGGCAGG 0: 1
1: 0
2: 16
3: 111
4: 634
Right 950451149 3:13066597-13066619 GAACGTTGTGGGATCGTGGGAGG 0: 1
1: 0
2: 1
3: 7
4: 497
950451141_950451145 -7 Left 950451141 3:13066569-13066591 CCTTCCAGGCAGGGCTGGGCAGG 0: 1
1: 0
2: 16
3: 111
4: 634
Right 950451145 3:13066585-13066607 GGGCAGGAGTTGGAACGTTGTGG 0: 1
1: 1
2: 0
3: 16
4: 235
950451141_950451147 1 Left 950451141 3:13066569-13066591 CCTTCCAGGCAGGGCTGGGCAGG 0: 1
1: 0
2: 16
3: 111
4: 634
Right 950451147 3:13066593-13066615 GTTGGAACGTTGTGGGATCGTGG 0: 1
1: 0
2: 0
3: 4
4: 40
950451141_950451153 26 Left 950451141 3:13066569-13066591 CCTTCCAGGCAGGGCTGGGCAGG 0: 1
1: 0
2: 16
3: 111
4: 634
Right 950451153 3:13066618-13066640 GGCCAGGAGGACCAGGAGAGAGG 0: 1
1: 0
2: 7
3: 77
4: 655
950451141_950451154 27 Left 950451141 3:13066569-13066591 CCTTCCAGGCAGGGCTGGGCAGG 0: 1
1: 0
2: 16
3: 111
4: 634
Right 950451154 3:13066619-13066641 GCCAGGAGGACCAGGAGAGAGGG 0: 1
1: 1
2: 2
3: 64
4: 629
950451141_950451151 13 Left 950451141 3:13066569-13066591 CCTTCCAGGCAGGGCTGGGCAGG 0: 1
1: 0
2: 16
3: 111
4: 634
Right 950451151 3:13066605-13066627 TGGGATCGTGGGAGGCCAGGAGG 0: 1
1: 0
2: 1
3: 27
4: 329
950451141_950451146 -6 Left 950451141 3:13066569-13066591 CCTTCCAGGCAGGGCTGGGCAGG 0: 1
1: 0
2: 16
3: 111
4: 634
Right 950451146 3:13066586-13066608 GGCAGGAGTTGGAACGTTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 127
950451141_950451148 2 Left 950451141 3:13066569-13066591 CCTTCCAGGCAGGGCTGGGCAGG 0: 1
1: 0
2: 16
3: 111
4: 634
Right 950451148 3:13066594-13066616 TTGGAACGTTGTGGGATCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 48
950451141_950451150 10 Left 950451141 3:13066569-13066591 CCTTCCAGGCAGGGCTGGGCAGG 0: 1
1: 0
2: 16
3: 111
4: 634
Right 950451150 3:13066602-13066624 TTGTGGGATCGTGGGAGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 199
950451141_950451152 19 Left 950451141 3:13066569-13066591 CCTTCCAGGCAGGGCTGGGCAGG 0: 1
1: 0
2: 16
3: 111
4: 634
Right 950451152 3:13066611-13066633 CGTGGGAGGCCAGGAGGACCAGG 0: 1
1: 0
2: 5
3: 42
4: 496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950451141 Original CRISPR CCTGCCCAGCCCTGCCTGGA AGG (reversed) Intronic
900086786 1:902411-902433 ACTGCCCTGCACTGCCTAGAAGG + Intergenic
900197078 1:1381873-1381895 CCTGCCCTGCCCTGTGTGAAGGG - Intergenic
900363258 1:2300078-2300100 CCTGCCCTGCCCTGGCAGGGGGG + Intronic
900470743 1:2853769-2853791 CCTGCCCCGCCCAGCCAGGAAGG + Intergenic
900482254 1:2905013-2905035 CCCGCCCTGCCCTGCCCGGCCGG + Intergenic
900547730 1:3237817-3237839 CCTGCCCCGCCCAGCCAGCAAGG - Intronic
900604355 1:3517168-3517190 CCTGCCTGGCCCTGCCAGGAGGG - Intronic
900612674 1:3550961-3550983 GCTGCCCAGCCCTGGCCGGCTGG - Intronic
900649672 1:3724552-3724574 CCTGCCTAGGCCTGCCAGGAAGG + Intronic
900695413 1:4006481-4006503 TGAGTCCAGCCCTGCCTGGAGGG - Intergenic
900711970 1:4120061-4120083 CTTGCTCAGCTCTGCCTGGTGGG + Intergenic
901007464 1:6179029-6179051 CCTACCCAGCTGTGCCAGGAGGG + Intronic
901078637 1:6571247-6571269 CCAGCCCAGACTTGCCTGAAGGG - Intronic
901211172 1:7526840-7526862 GGTGGCCAGCCCTGGCTGGAGGG - Intronic
901538907 1:9901968-9901990 TCTACCCAGCCCTGGCTGGAGGG + Intronic
902246233 1:15122622-15122644 CCTGCCCAGCCCCACCTGCAGGG - Intergenic
902531898 1:17096003-17096025 CCTGCCCTGCCCTGCCTGGCAGG - Intronic
902641534 1:17769460-17769482 TCAGCTCAGCCCTGTCTGGAAGG - Intronic
902871706 1:19317636-19317658 CCGGTGCAGCCCTGCCTGGCCGG + Exonic
903070912 1:20726684-20726706 CCTGCCCCGCCCTGGCTGGTGGG - Intronic
903142173 1:21345327-21345349 CCGGTCCAGCCCAGCCTCGACGG - Intronic
903282399 1:22257421-22257443 CTGGCTCAGCCCTGCCTGGTAGG - Intergenic
903374078 1:22854818-22854840 CCAGCCCAGCCCAGCCCAGAGGG + Intronic
903600602 1:24535971-24535993 CCTGGGCAGCCATGTCTGGAGGG - Exonic
903604855 1:24568073-24568095 CAGGCCCAGCCCTGCCTGGAAGG - Intronic
903651600 1:24925885-24925907 CCTCCCCAGGCCTGCAGGGAGGG - Intronic
904425163 1:30418134-30418156 CCAACCCAGCTCTGCCTGGCTGG - Intergenic
904611140 1:31726981-31727003 TCAGTCCAGCCCTGCCTGGGAGG - Intergenic
904896722 1:33823259-33823281 CCTGCTCAGTCCTCCCTGGAAGG - Intronic
904914711 1:33961397-33961419 CATGCCCTGTCCTGCTTGGAAGG + Intronic
905108016 1:35575427-35575449 CCTCCAAGGCCCTGCCTGGAAGG - Intronic
905172334 1:36116517-36116539 CCTGCCCTGCCTTGCCCTGAAGG + Intronic
905242484 1:36589832-36589854 CCTGGCTCACCCTGCCTGGATGG + Intergenic
905410112 1:37762806-37762828 CCAGCCCAGCTCGGCCTGGGAGG + Exonic
905562994 1:38941875-38941897 CCGGCCCAGCCCAGCTGGGAGGG - Intergenic
905747680 1:40433170-40433192 CCAACCCATCCCTGCCTGGCAGG + Intergenic
905894322 1:41535267-41535289 CCACCCCAGCGCTGGCTGGAAGG - Intronic
906106132 1:43293769-43293791 CCCTCCCAGCCCTGCCTGCCTGG + Intergenic
906123407 1:43410942-43410964 CCTGTGCTGCCCTGCCTGGGTGG + Intronic
906726223 1:48046491-48046513 GCTGCCCAGCCTGCCCTGGAAGG - Intergenic
906800624 1:48734040-48734062 CCTGCCCTGCCCTGCCTGGTAGG - Intronic
907043913 1:51288056-51288078 CCTGCCCTGCCCTGCCTTTGGGG - Exonic
907109065 1:51909873-51909895 CCTGCCTAGCTCTGCCTGATTGG + Exonic
907243535 1:53093411-53093433 CCCGGCCAGCCCTGGGTGGATGG - Intronic
907305233 1:53509470-53509492 CCTGCCCTCCCCTCCCTGCAGGG - Intronic
907773115 1:57485997-57486019 CCTGCTCACCCCTTCCAGGAAGG + Intronic
907924376 1:58941950-58941972 TCTGCCCTGCACTGCCAGGAAGG - Intergenic
908143145 1:61209000-61209022 CATTCCCAGCGCTGCCTGGGAGG + Intronic
908360941 1:63367827-63367849 CCTCCCCAGCCCTTCCTGCAGGG + Intronic
908741151 1:67328957-67328979 GCAGCCCAGTTCTGCCTGGATGG - Intronic
908793122 1:67802780-67802802 CCTGCCCACCACTCCCTGGTTGG + Intronic
909407666 1:75310480-75310502 CATGACCATCCCTACCTGGAAGG + Intronic
910674282 1:89801188-89801210 CATGCCCAGCCCTGCTGTGATGG + Intronic
911182213 1:94871301-94871323 CCTGACCAGCCTTTTCTGGATGG - Intronic
913073537 1:115322183-115322205 CCTGCCCAGCACTTTCTGGCAGG + Intronic
914339623 1:146748927-146748949 CCTGCCCCTCCCAGCCAGGAAGG - Intergenic
914813884 1:151048761-151048783 CCTGCCCAGCCCTGGCTTTTTGG + Exonic
915117946 1:153612198-153612220 CCTGCCCAGCCCAGTGGGGATGG - Intronic
915277966 1:154802714-154802736 CATGCCTAGCCCTGGCTGGAGGG - Intronic
915733074 1:158067716-158067738 CCAGCACAGTCCTGCCAGGAAGG - Intronic
916414450 1:164579474-164579496 CCTGCCCAGTCCTGCTGGTAAGG + Intronic
916932776 1:169596465-169596487 CCTGCCCAACCCTGCCTTATTGG + Intronic
918303526 1:183225490-183225512 CCTTCCCAGTCCTGCTTAGAAGG - Intronic
918685365 1:187408356-187408378 CTTGCCCAGGCATGCCTGCAAGG - Intergenic
919453794 1:197800550-197800572 CCTGCCCAGTCCTGCAAGGGTGG - Intergenic
919814249 1:201427877-201427899 CCCACCCAGGCCTTCCTGGAGGG - Intronic
919924798 1:202186699-202186721 GCTGCCCAGCCCAGCCTGCGAGG - Intergenic
920033103 1:203048995-203049017 CCAGCCCCGCCCAGCCTGGGAGG + Intronic
920046440 1:203135914-203135936 CCTGCCCAACCCAGCCCAGAAGG - Intronic
920504484 1:206506861-206506883 CCTTCGCAGCCCTGCCGGGTAGG - Intergenic
920647562 1:207814609-207814631 TCTGGCCAGCCCTGGCTGTAGGG - Intergenic
921342952 1:214152934-214152956 TTTCCCCACCCCTGCCTGGAAGG - Intergenic
922592243 1:226785958-226785980 CCTGCCCAGCCCCACATGGAAGG - Intergenic
922744278 1:228035574-228035596 CCATCCCCGCCCTGCCCGGAGGG - Intronic
922744421 1:228036180-228036202 CCTGACCACCCCTGCCAAGATGG + Intronic
922787931 1:228292514-228292536 CCTTCCCAGCTCTGCCTGCCAGG + Exonic
923105292 1:230849518-230849540 CCAGCCCTGGCCTGGCTGGAGGG - Intronic
923254677 1:232211328-232211350 ACTGCCCAGCTCTGCCTCTAGGG + Intergenic
924738639 1:246781404-246781426 CCTTCCCAGCCCAGCATGGCAGG + Intergenic
1063364329 10:5480662-5480684 CCTGCCTTCCCCTCCCTGGAGGG + Intergenic
1063477713 10:6343368-6343390 CCTGCCCAGCCCTGCATCTGAGG + Intergenic
1064585258 10:16833561-16833583 TCTGCCCAGCCTGGCCAGGAAGG - Intronic
1065094068 10:22263553-22263575 CCTGCCCAGCACTGGGTGGCAGG - Intergenic
1067068951 10:43118878-43118900 CCAGCCCCGCCCTGCATGGCAGG + Intronic
1067226998 10:44383040-44383062 CCTTCCCAAGCCTGCTTGGAGGG - Intronic
1067270708 10:44789239-44789261 CCTCCTCAGCCCTGTCTGGCTGG + Intergenic
1067286219 10:44909264-44909286 CCTGCCAAGCCAGGCCCGGAAGG + Intergenic
1067296482 10:44977804-44977826 CCAGCCCAGGCCTGCCGGAAGGG - Exonic
1067667062 10:48287871-48287893 CCTGCCAAGCACTGTCTGGCTGG - Intergenic
1067711644 10:48655581-48655603 CCTTCCCAGCGCTGCCCGGCAGG - Intronic
1067762320 10:49057609-49057631 CACTCCCACCCCTGCCTGGAGGG + Intronic
1068523884 10:58106377-58106399 CCTGGCCAGCCCTGCCTGCGGGG - Intergenic
1069630897 10:69896517-69896539 GCTGCCCACCCCTGCCAGGCAGG + Intronic
1069662273 10:70131736-70131758 CCTGCCCAGCCCACCCTGGCTGG + Intronic
1069784909 10:70981615-70981637 TTTCCCCAGCCCTGCCAGGAGGG - Intergenic
1070395877 10:76010861-76010883 CATGGCCAGCCCTGGCTGAACGG + Intronic
1070828662 10:79405646-79405668 CCAGCCCAGCCTTCCCTGGCTGG + Intronic
1070890975 10:79942034-79942056 CCTGCCGAGCCCTGCATGCCTGG + Exonic
1070967764 10:80539908-80539930 CCAGCGCAGCCCAGCCCGGAAGG - Intronic
1071571293 10:86698912-86698934 CCTGCCCAGCCCTCACTACATGG + Intronic
1072319430 10:94234180-94234202 CCTGCACATCCCTGGCTGTAAGG + Exonic
1072629027 10:97132828-97132850 CATCCCCTTCCCTGCCTGGATGG + Intronic
1073190753 10:101649275-101649297 CCTGCCAAGGCCTGGCTGGGAGG - Intronic
1073452872 10:103619896-103619918 CCTGCCTAGCCCTGCCAGGGAGG - Intronic
1073541045 10:104316274-104316296 CCTACCCAGACATTCCTGGATGG + Intronic
1075006695 10:118835812-118835834 CCTGGCCAGCCCTGCAGAGATGG + Intergenic
1075550043 10:123385647-123385669 CCTGCTGAGCCCAGCCTAGATGG - Intergenic
1075622777 10:123939933-123939955 CCTACCCAGCTCTGCCTGTGTGG - Intronic
1076335793 10:129705787-129705809 TCTCCCCAGCCCTGTGTGGATGG - Intronic
1076335825 10:129705904-129705926 TCTGCCCGGCCCTGTGTGGATGG - Intronic
1076347290 10:129788246-129788268 CTTGCCCAGAGCTGGCTGGAGGG - Intergenic
1076374163 10:129972583-129972605 CCTGGCGAGCACTGCCTGGGAGG - Intergenic
1076549309 10:131267705-131267727 CCTGCCCAGCCATGCAAGGGTGG + Intronic
1076556238 10:131323034-131323056 CATGCCCAGCACTGGGTGGAGGG + Intergenic
1076567744 10:131410492-131410514 CCTTCCCTGCCCTGCGTGGAAGG - Intergenic
1076727612 10:132420816-132420838 CCTTCCAAATCCTGCCTGGACGG + Intergenic
1076748004 10:132523988-132524010 CTGGCCCAGCCCTGCCTGTATGG - Intergenic
1076881162 10:133239847-133239869 CCTGCCCACCCCAGCCTGCCCGG - Intronic
1077376886 11:2209389-2209411 CCTTCCCAGCCCAGGCTGGGCGG + Intergenic
1077443211 11:2578308-2578330 CCAGCCCAGCCTTGCCAGCAGGG + Intronic
1077754696 11:5014312-5014334 TCTTCCCTGACCTGCCTGGATGG + Intergenic
1078105358 11:8354889-8354911 TGTGCCCAGCCCTGCCAGGCTGG - Intergenic
1079094075 11:17499893-17499915 CCAGCCTAGGACTGCCTGGAAGG + Intronic
1079243452 11:18736850-18736872 CGATCCCAGCCCTACCTGGAGGG - Intronic
1080109260 11:28547004-28547026 CCTGCACAGCCCAGGCTGCATGG + Intergenic
1081647875 11:44802555-44802577 CCTCCCCAGCCCCCACTGGATGG + Intronic
1082160750 11:48885437-48885459 CCTGCCTAGAACCGCCTGGAGGG + Intergenic
1082161616 11:48894969-48894991 CCTGCCTAGAACCGCCTGGAGGG - Intergenic
1082167198 11:48963398-48963420 CCTGCCTAGAACTGCCTGGAGGG - Intergenic
1082236380 11:49823301-49823323 CCTGCCTAGAACTGCCTGGAGGG + Intergenic
1082239830 11:49857808-49857830 CCTGCCTAGAACTGCCTGGAGGG + Intergenic
1082609868 11:55283176-55283198 CCTGCCTAGAACTGCCTGGAGGG + Intergenic
1082656813 11:55867347-55867369 CCTGCCTAGAACTGCCTGGAGGG - Intergenic
1083255958 11:61495673-61495695 CCTGCACAGCCTGACCTGGAAGG + Intergenic
1083623321 11:64059519-64059541 CCAGGCCATCCCTGCCTGCAGGG + Intronic
1083677267 11:64333090-64333112 CCTTCCCAGCCCCGCCTGTGTGG + Intergenic
1084115969 11:67043123-67043145 CAAGCCCAGTCCTGCCTGGTGGG - Intronic
1084153520 11:67302097-67302119 CCTCCCCTGCCCTGCCTGGAAGG + Exonic
1084276560 11:68054291-68054313 CCAGCCCAGCCCTGCCTCTCAGG + Intronic
1084428394 11:69097887-69097909 CCGGCCCACCCCTGCATGGCTGG + Intergenic
1084485150 11:69443736-69443758 GCTGCCAGGCCCTGCCTGGGAGG - Intergenic
1084669166 11:70595205-70595227 CCTGGCCAAAGCTGCCTGGAGGG - Intronic
1084701428 11:70788705-70788727 CCTGCCCAGCCCTGACCCCAGGG + Intronic
1084913758 11:72412069-72412091 CCCTCCCAGCCCTGGCTGGCAGG - Intronic
1084962470 11:72724436-72724458 CCTGCCCACCCCCGCCTTGTGGG - Intronic
1085312772 11:75525973-75525995 CCTGCGCGGCCCCGCCCGGACGG + Intergenic
1085769201 11:79309969-79309991 CACATCCAGCCCTGCCTGGAAGG - Intronic
1085774429 11:79352611-79352633 CCTGCCCAGGCCTGTCTGTTGGG - Intronic
1087907024 11:103710081-103710103 CCCACCCAGCTCTGCCAGGAAGG + Intergenic
1089138879 11:116270777-116270799 CCTGCCCAGCTCTGCCAGGAGGG - Intergenic
1089138906 11:116270984-116271006 TCTGAGCAGACCTGCCTGGAAGG - Intergenic
1089214416 11:116827217-116827239 GCTGCCCAGCCCAGCCTGGTGGG + Intergenic
1089249128 11:117144750-117144772 CCTGCCCTGCCCTGCCCTGCCGG + Intronic
1089331276 11:117690668-117690690 CATGCTCACCCCTCCCTGGAAGG + Intronic
1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG + Intronic
1090184170 11:124725445-124725467 CCAGGCCTGCCCTGCCAGGAAGG + Intergenic
1090379127 11:126312965-126312987 CAGGCCCTGCCCAGCCTGGAGGG - Intronic
1090465255 11:126927835-126927857 CCTGGACAGCCTTGTCTGGATGG - Intronic
1090830988 11:130420709-130420731 CCTGCCAACCCCTGCTTGTAGGG - Intronic
1090915777 11:131160763-131160785 CTGGCCCAGCCCTGCTTGGAGGG - Intergenic
1090944696 11:131419592-131419614 CCTACCCAGCCCAGCCACGATGG - Intronic
1091266776 11:134277081-134277103 ACTGCCCAGCCCTGTCTGGAGGG + Intronic
1091674315 12:2477672-2477694 CCAGCCCAGACCTGCAGGGAAGG - Intronic
1091727091 12:2853853-2853875 ACTTCTCAGCCCTGCCTGGAGGG + Intronic
1091815217 12:3432546-3432568 TCTGCCCAGCCCAGGCAGGAAGG + Intronic
1091848604 12:3677510-3677532 TCTGCCCAGCCCTCACTGCAGGG - Intronic
1091906918 12:4196800-4196822 ACTGCCCAGTCCTGCATGGTGGG + Intergenic
1091980163 12:4858243-4858265 CCAGCCCAGCCCTCCCTTGCTGG - Intergenic
1092773785 12:11923206-11923228 ACTGCTCAGCTCTTCCTGGAAGG - Intergenic
1093703957 12:22254437-22254459 CCTGCCCAGCCCTGATTTCAAGG + Intronic
1094176413 12:27546308-27546330 CCAGCCCAGCCCTCACTGGGAGG + Intronic
1094601762 12:31915205-31915227 CCTGCCCAGTCTTGTCTGAATGG + Intergenic
1096755587 12:53796723-53796745 CCAGCCCAGCCCTTCCAGAAAGG - Intergenic
1096795942 12:54077618-54077640 CTGGCCCAGCGGTGCCTGGAAGG + Intergenic
1097687382 12:62703622-62703644 CCTGTCCAGCCAGGCCTGGGTGG - Intronic
1097733202 12:63152006-63152028 CCTGGACAGCACTGCCTGGATGG - Intergenic
1097739359 12:63221044-63221066 CATGGCCAGCCCTGCCTGGAGGG + Intergenic
1097849788 12:64400552-64400574 ACTGCCCATCCCTTCATGGACGG + Intergenic
1101615295 12:106330420-106330442 CCCGCCCTGCCCTGCCAGGATGG - Intronic
1102043567 12:109815979-109816001 GGTGCCCAGCCCTGCCTGGCTGG - Intronic
1102044863 12:109823310-109823332 CCAGACCTGCCCTGCCTGGGTGG - Intronic
1102077688 12:110073163-110073185 CCTGCCCTGCTCTCCCTGGCGGG + Intronic
1102177434 12:110886570-110886592 CCTGCTATGCCCTTCCTGGAGGG + Intronic
1102406142 12:112676014-112676036 CCTGGGCAGTCCTGCCTGGCAGG + Intronic
1102731604 12:115116096-115116118 CCTGCCCTGTCCTTGCTGGATGG + Intergenic
1103081977 12:118031404-118031426 CCTGCCCATCCTCTCCTGGAAGG - Exonic
1103738375 12:123075391-123075413 CCTGCCCAGCACAGCCTGGGTGG + Intronic
1103838880 12:123846594-123846616 CTTCCCAAGCTCTGCCTGGATGG - Intronic
1103960653 12:124607225-124607247 CCTGCCCTCCCTTGCCTGGACGG + Intergenic
1103969195 12:124659450-124659472 CCTGCCCCACCCTGTCTTGATGG + Intergenic
1104393944 12:128415402-128415424 CCAGCCCATCCTTTCCTGGACGG - Exonic
1104567182 12:129895554-129895576 CCTGCACAGCCCTGGCTGCCAGG + Intronic
1104794282 12:131506329-131506351 TCTGTCCAGCCCTGCCTGCAAGG - Intergenic
1104859833 12:131918202-131918224 CCAGCCCAGATCTGCCTGGGAGG - Intronic
1104980744 12:132572199-132572221 ACTGCCCAGCCCGGCCAGGTGGG + Intronic
1105248905 13:18678190-18678212 CCTGCCCTGGCTTGCCTAGAAGG + Intergenic
1105546255 13:21352971-21352993 TCTGCCAGGCCCTGCCTGCAGGG + Intergenic
1105585414 13:21738646-21738668 CCAGCCCTGCCCTGCATGGAAGG - Intergenic
1105779601 13:23695319-23695341 CCCGCCCAGGCCTTTCTGGAGGG - Intergenic
1106840663 13:33682331-33682353 CGTCCCCATCCCTGCCTGGGGGG - Intergenic
1110842796 13:80161983-80162005 CCTGCCCTGCCTTCCCTGGAAGG - Intergenic
1112191606 13:97183653-97183675 CTTGCCCAGCTCTGACAGGAAGG + Intergenic
1112371208 13:98795351-98795373 CATGCCCAGTGGTGCCTGGAAGG + Intronic
1113054302 13:106251576-106251598 CCTGCCCAGGCTTTTCTGGAAGG - Intergenic
1113496210 13:110731267-110731289 CCTTCCCAGCCCTGCCCAAATGG + Intergenic
1113514818 13:110886094-110886116 CATGGCCAGGCCTGCCTGGATGG - Intronic
1113679854 13:112235666-112235688 CTTGACCAGCCTTGCCTGAAAGG + Intergenic
1113868753 13:113545631-113545653 CCAGGGCAGCCCTGCCTTGAAGG + Intronic
1113868768 13:113545696-113545718 CCAGGGCAGCCCTGCCTTGAAGG + Intronic
1114557884 14:23572075-23572097 GCTGCCCTGGCCTGCCAGGAAGG - Intronic
1115711606 14:36057013-36057035 CCTGCACAGTCCTCCCTGGAGGG - Intergenic
1116764688 14:49055452-49055474 CCTGCCCAGAATTGCCTGGTGGG - Intergenic
1118867910 14:69717865-69717887 CCTGCCCAGCCCTGATCTGAAGG - Intergenic
1119420203 14:74503723-74503745 TCAACCCAGCCCAGCCTGGAAGG + Intronic
1119428199 14:74549715-74549737 ACTTCCCAGACCTGCCTTGAAGG - Intronic
1119539529 14:75428953-75428975 CTTGCCCAGCCCAGCTTAGAAGG + Intronic
1120979789 14:90279725-90279747 CCTTCCCAGCCCAGTGTGGAAGG + Intronic
1121315295 14:92957824-92957846 CCTGCCCTGGCTTCCCTGGAAGG + Intronic
1121644888 14:95510989-95511011 GCAGCCCAGCCCAGCCTGGGCGG - Intergenic
1121712028 14:96045545-96045567 CTTGGCCAGCCTGGCCTGGATGG + Intronic
1122153591 14:99737671-99737693 TCTGCCCAGCCCAGCATGGGGGG + Intronic
1122312465 14:100805836-100805858 CCTCCCCAGCCCTGTCTCCATGG + Intergenic
1122534810 14:102454836-102454858 CCTTCCCAGCCCCTCCAGGAAGG + Intronic
1122576556 14:102746695-102746717 CCTGCCCGGCTCTTCCTGCAGGG - Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122750397 14:103928601-103928623 CCTGGCCGCCCCTGCCGGGAAGG - Exonic
1122783202 14:104152390-104152412 CAGGCCCAGCAGTGCCTGGAGGG + Exonic
1122816122 14:104314912-104314934 CCTGCCCAGCCCTGCCTCTGGGG + Intergenic
1122878739 14:104680488-104680510 CCTGGCCTGGCCTACCTGGAGGG - Intergenic
1122891258 14:104733269-104733291 TCTGCCTGGCCCTGCCTGGCTGG - Intronic
1122905179 14:104798275-104798297 CCTAGCCTGCCCTGCCTGGCTGG - Intergenic
1123025701 14:105422724-105422746 CCTGCCTAGCCCAACCTGGCAGG - Intronic
1123126029 14:105946873-105946895 CCTGCACAGCCCAGGCTGCAGGG + Intergenic
1123406615 15:20023295-20023317 CCTGCACAGCCCAGGCTGCAGGG + Intergenic
1123500690 15:20878351-20878373 GCTGCTCAGCCCTGCCCGGCGGG + Intergenic
1123515945 15:21029943-21029965 CCTGCACAGCCCAGGCTGCAGGG + Intergenic
1123557935 15:21452044-21452066 GCTGCTCAGCCCTGCCCGGCGGG + Intergenic
1123594164 15:21889325-21889347 GCTGCTCAGCCCTGCCCGGCGGG + Intergenic
1124448539 15:29763113-29763135 CCTGCCCACATCTGCCTGGCTGG - Intronic
1124693821 15:31847001-31847023 CCTTCCCTGCCCTGCCTAGCAGG - Intronic
1125501379 15:40241993-40242015 CCTGCTCAGCTCTGCATGCATGG - Intronic
1126581749 15:50248425-50248447 CCTGCCCAGCCCTCCAGGGATGG + Intronic
1127345696 15:58095676-58095698 CCTGCCCTGCTCTGACAGGAAGG + Intronic
1127766922 15:62195398-62195420 CCAGCCCAGCCCTGCCCCGGGGG + Intergenic
1127770159 15:62224357-62224379 CCTCCCCTGCCCTGCCTGGTGGG + Intergenic
1128217055 15:65941862-65941884 CAGGGCCAGCCCTGTCTGGAGGG - Intronic
1128231357 15:66037689-66037711 CCTGCCGAGGGCTGCCAGGATGG - Intronic
1129117315 15:73371785-73371807 CCTTTCCAGCACTGCCTAGAAGG + Intergenic
1129190839 15:73936757-73936779 CCTGCCCAGCGGTTCCTGGAGGG - Intronic
1129297021 15:74605092-74605114 CCTGGCCTGCCCTCCCTGGCTGG + Intronic
1129426825 15:75469462-75469484 CCCATCCAGCCCTCCCTGGAGGG - Intronic
1129457568 15:75683815-75683837 CAGGCCCAGCCCTGGCAGGAGGG + Intronic
1129726228 15:77903129-77903151 CAGGCCCAGCCCTGGCAGGAGGG - Intergenic
1129858296 15:78840815-78840837 CCTGCCCTGCCCTGCTGGGTGGG + Intronic
1130322610 15:82853511-82853533 CCTGCCCTGCCCGACCTGGAGGG - Intronic
1131121030 15:89823524-89823546 CCTGCCCTGCCCTGCCCTGGGGG - Intergenic
1131146963 15:90020381-90020403 CTGGGACAGCCCTGCCTGGACGG - Intronic
1131432871 15:92400748-92400770 GCTGCCCCCTCCTGCCTGGAAGG + Intronic
1131536974 15:93245591-93245613 TCTGCCCAGCCTTCCTTGGATGG - Intergenic
1131868932 15:96741789-96741811 CCTGCCTGGCCCTGACTGGCTGG + Intergenic
1132049061 15:98591968-98591990 CCCATACAGCCCTGCCTGGAGGG + Intergenic
1132144158 15:99417030-99417052 CCTGCCCAGCCCTGAGAGGCAGG + Intergenic
1202966286 15_KI270727v1_random:179216-179238 GCTGCTCAGCCCTGCCCGGCGGG + Intergenic
1132502814 16:292102-292124 CCTGCTCAGCCCAGCAAGGATGG + Intronic
1132656910 16:1045252-1045274 CCTGCTCAGCCCTGCCCGCTTGG + Intergenic
1132744669 16:1431670-1431692 GCTGCCCAGCCCCTCCTCGAGGG - Intergenic
1132837397 16:1960976-1960998 CCTTCACAGGCCTGCCTGGCTGG + Intronic
1132867860 16:2102777-2102799 CCTGCCCTGCCCTGCCAGGCTGG + Intronic
1132936930 16:2486028-2486050 GCTGCCCTCCCCTGCCTGGCGGG + Intronic
1134007513 16:10828023-10828045 CCTCCCCAGCCCTGCCTCCATGG - Intergenic
1134034431 16:11018829-11018851 CCTGGCCATCCCTGCCTGGCTGG - Intronic
1134523914 16:14930337-14930359 CCTGCCCTGCCCTGCCAGGCCGG - Intronic
1134548990 16:15130598-15130620 CCTGCCCTGCCCTGCCAGGCCGG + Intronic
1134711505 16:16328822-16328844 CCTGCCCTGCCCTGCCAGGCCGG - Intergenic
1134719356 16:16372121-16372143 CCTGCCCTGCCCTGCCAGGCCGG - Intergenic
1134948070 16:18339764-18339786 CCTGCCCTGCCCTGCCAGGCCGG + Intergenic
1134955324 16:18379871-18379893 CCTGCCCTGCCCTGCCAGGCCGG + Intergenic
1135932894 16:26754313-26754335 CCTGCAAAGCCCTGCATAGATGG - Intergenic
1136576305 16:31127365-31127387 CCTGCCCAGCTCGGCCCGGCCGG - Intronic
1136710631 16:32234039-32234061 CCTACCCAGCCATCCCAGGATGG + Intergenic
1136757280 16:32695372-32695394 CCTACCCAGCCATCCCAGGATGG - Intergenic
1136776560 16:32874872-32874894 CTTGCCCAGCCTAGACTGGAGGG + Intergenic
1136810828 16:33175003-33175025 CCTACCCAGCCATCCCAGGATGG + Intergenic
1136817304 16:33285083-33285105 CCTACCCAGCCATCCCAGGATGG + Intronic
1136823867 16:33341612-33341634 CCTACCCAGCCATCCCAGGATGG + Intergenic
1136894055 16:33986641-33986663 CTTGCCCAGCCTAGACTGGAGGG - Intergenic
1137252010 16:46747684-46747706 GCTTCCCTGCCCTGGCTGGATGG - Intronic
1137520947 16:49195090-49195112 CCCGCCTACCCCTGGCTGGACGG - Intergenic
1137567979 16:49545500-49545522 CATGCCCAGCCCTGCCAGCCAGG + Intronic
1137584834 16:49658218-49658240 CCTGCACTGCCCTGTCTGGAGGG - Intronic
1137605304 16:49783183-49783205 CCCGCCCATCCCAGCCTGGCAGG - Intronic
1138113950 16:54345438-54345460 CCTCCCCAGCCCTGGCTGTCAGG + Intergenic
1138392023 16:56676897-56676919 CCTGCCCATCCCAGCCTGTGGGG + Intronic
1138418730 16:56886084-56886106 CCTGCCTAGCCCAGCATGGTGGG - Intronic
1139371533 16:66472180-66472202 CCTATCCAGCTCTGCCTGGTAGG - Intronic
1139493302 16:67298927-67298949 CCTGCCCTGCCCTGCTTCTAAGG + Intronic
1139550329 16:67669261-67669283 CCTGTCCACCCCTGCCTGCCAGG - Intergenic
1139750549 16:69106784-69106806 CCTCCCCTGGCCGGCCTGGAGGG + Intronic
1139956534 16:70695899-70695921 CCTGCCCAGCCCTCCCCCAACGG - Intronic
1139994663 16:70968481-70968503 CCTGCCCCTCCCAGCCAGGAAGG + Intronic
1141604103 16:85143172-85143194 TCTGCCCAGCCCTGCCTGGCCGG + Intergenic
1141625942 16:85261102-85261124 CCTTACCACCCCCGCCTGGAGGG + Intergenic
1141703062 16:85651242-85651264 CCTGCCGGGCCTTGCCTGGATGG + Intronic
1141828855 16:86498513-86498535 CCTGCCCGCCCCAGCCAGGAGGG - Intergenic
1141842317 16:86580999-86581021 CCCTCCCAGCCCTGCCAGGCAGG + Exonic
1141846243 16:86610946-86610968 GCTTCCCAGCCCTTCCTGGCAGG + Intergenic
1142024306 16:87804381-87804403 CCTGCCCCGCCCAACCTGAAGGG + Intergenic
1142259761 16:89037220-89037242 CCTGCCCAGCACTCACTGCAGGG - Intergenic
1203059430 16_KI270728v1_random:955723-955745 CCTACCCAGCCATCCCAGGATGG - Intergenic
1203078975 16_KI270728v1_random:1136981-1137003 CTTGCCCAGCCTAGACTGGAGGG + Intergenic
1142472077 17:170232-170254 CATGTCCAGCCCTGCCTGGCGGG - Intronic
1142639813 17:1279425-1279447 CCAGCCCAGCCCAGCCCAGAGGG - Intergenic
1142666258 17:1465570-1465592 CCTGCCCATCCCTCTCTTGAGGG - Exonic
1142885960 17:2912218-2912240 CCAGCCCAGCTCTGCCCAGAGGG - Intronic
1143388086 17:6543845-6543867 CCTGCCCACCCCTTCCTTGGAGG - Intronic
1143610960 17:8017101-8017123 TCTGCCCAGCTCTGCCTCAAAGG + Intronic
1143627241 17:8117657-8117679 TCTCCACAGTCCTGCCTGGATGG + Intronic
1144581422 17:16461528-16461550 GCAGCTCAGCCCTGCCTGGATGG - Intronic
1144620349 17:16814821-16814843 GTGGCCCAGCCCTGCCTGGCTGG - Intergenic
1144668058 17:17115418-17115440 CCTGCCAACCCAGGCCTGGAAGG - Intronic
1146584378 17:34069601-34069623 CTTGCCTAGCCCTGGATGGAGGG - Intronic
1147445220 17:40471189-40471211 CCTGGCCAACCCTGCCTGCCTGG + Intergenic
1147790539 17:43011996-43012018 CCAGCCAAGCCCTGGGTGGAGGG + Intronic
1147864894 17:43545698-43545720 CCATCGCAGCCCTCCCTGGACGG - Intronic
1148148134 17:45378939-45378961 CCGGCCCTGCCCTGCCTGCTGGG + Intergenic
1148211166 17:45809544-45809566 CCAGCCCAGCCCAGCCTGCCTGG + Intronic
1148558842 17:48594480-48594502 CCCGCCCAGCCCTGCCGGCTCGG - Intronic
1148683456 17:49487484-49487506 CCAGCCCAGCCCAGCCTACAGGG - Intergenic
1149446684 17:56718636-56718658 CCTCTCCAGCCCTAGCTGGAGGG - Intergenic
1150168340 17:62966165-62966187 CCTCCCCACCCCAGCCCGGAGGG + Intergenic
1150295798 17:64006721-64006743 CCAGCCAAGGGCTGCCTGGAGGG + Exonic
1150984236 17:70177315-70177337 CCTGGCCAGCACTGCCTAGCAGG - Exonic
1151183992 17:72350119-72350141 CCTGCCCATCACAGCCTGCACGG + Intergenic
1151539760 17:74758935-74758957 CCAGCCCATCCCAGCCTGGGTGG - Intronic
1151548570 17:74808186-74808208 CCAGCCCAGTCCTGCCCTGAAGG + Intronic
1151674456 17:75590364-75590386 CCTGCCCCTTCCTGCCAGGAGGG - Intergenic
1151714012 17:75822403-75822425 CCTGGCCAGCCCTGCCTCAGAGG - Intronic
1151744721 17:76005731-76005753 CCTCACCTGCCCTGCCTGCAGGG + Exonic
1151836508 17:76585906-76585928 CCTGCCCCGCCCTGCCCGCCGGG + Exonic
1151961058 17:77405849-77405871 CCAGCCCAGCCCCACATGGAGGG - Intronic
1152009239 17:77700725-77700747 CCTGACCTCCCCTGCCTGGTAGG - Intergenic
1152051795 17:77984775-77984797 CCTCTCCAGTCCTGCGTGGAGGG + Intergenic
1152068001 17:78121978-78122000 CCTCCCCAGCCCTGCCCGCTGGG + Intronic
1152087892 17:78231635-78231657 CCTGCACAGCCCGGCCAGGCAGG + Exonic
1152095277 17:78268716-78268738 CCTGCACAGCCCTCCCTGCAAGG - Intergenic
1152107921 17:78341793-78341815 CCGGGGCAGCCCTGCCCGGAAGG - Intergenic
1152219060 17:79050934-79050956 CCTTCCCAGAGGTGCCTGGAGGG + Intergenic
1152310500 17:79547049-79547071 CTTGTCCAGCCCTGGATGGAAGG - Intergenic
1152581675 17:81168083-81168105 CCTCCTCTGCCCAGCCTGGAAGG + Intergenic
1152639947 17:81445216-81445238 TCTCCCCAACCCTGCCTGGCCGG + Intronic
1152706345 17:81845529-81845551 CCGCCCCAGCCCCGTCTGGAGGG + Intronic
1152746142 17:82040207-82040229 CCTCCCAACCACTGCCTGGAGGG + Intergenic
1152776274 17:82204031-82204053 GCTGACCAGCCCTTTCTGGAGGG - Intronic
1153583545 18:6599025-6599047 ACTGGCCAGCGCTGGCTGGAGGG - Intergenic
1154039720 18:10842402-10842424 CCTCCCCAACCCTTCATGGAGGG - Intronic
1154325712 18:13389250-13389272 GCTGCCCATCCCTGCCTGGAGGG - Intronic
1154325725 18:13389292-13389314 GCTGCCCATCCCTGCCTGGAGGG - Intronic
1154325738 18:13389334-13389356 GCTGCCCACCCCTGACTGGAGGG - Intronic
1154325755 18:13389376-13389398 GCTGCCCACCCCCACCTGGAGGG - Intronic
1154439972 18:14381046-14381068 CCTGCCCTGGCTTGCCTAGAAGG - Intergenic
1156350181 18:36296827-36296849 CCTGCCCGCCCCTGCCAGGCGGG - Intergenic
1157338089 18:46756174-46756196 TCTGCCCAGCGCTGGCTGGAGGG - Intronic
1157479644 18:48045198-48045220 GCTGGCCAAGCCTGCCTGGAGGG - Intronic
1157496067 18:48158418-48158440 CTAGCCCAGCCCTGCCTCTATGG + Intronic
1157593225 18:48848527-48848549 GCTGGCCAGCCCGGCTTGGATGG + Intronic
1158402502 18:57133711-57133733 CATTCACAGCCTTGCCTGGATGG - Intergenic
1160824945 19:1075071-1075093 CGCCCCCAGCTCTGCCTGGAAGG + Intronic
1160837517 19:1131791-1131813 CGGGCTCAGCCCTGCCCGGACGG - Intronic
1161080185 19:2306709-2306731 CCTTCCCTGCCCTGCCTGTCTGG - Intronic
1161163185 19:2771905-2771927 GCTGCCCAGCCCAGCCCGGAAGG - Intronic
1161194089 19:2976720-2976742 CCAGCCCAGCTCTGCCTGAGAGG + Intergenic
1161195476 19:2983972-2983994 CCTGCCCAGCCCCCACTGCAGGG + Intronic
1161479110 19:4501851-4501873 CCGCCCCTGCCCTGCCTGTAGGG - Intronic
1161593802 19:5141160-5141182 CCTGCACAGCCCTGCCCAGGTGG - Intronic
1161979839 19:7624621-7624643 CCTGCCCTGCACTGCCAGGGTGG + Intronic
1161984490 19:7646228-7646250 CCCTCCCTGCCCTGCCTGTAGGG + Exonic
1162016230 19:7847933-7847955 TCGGCCCAGCCCTGCCTGCCTGG - Intronic
1162328511 19:10012428-10012450 CCTGCCCTGCCCTGCCTTGCTGG + Intergenic
1162418651 19:10553264-10553286 CCTTCCCTACCCTGCCAGGAGGG - Exonic
1162475976 19:10899537-10899559 CCTCCTGAGCCCTGCCAGGAGGG - Intronic
1162737691 19:12755596-12755618 CCTGCCCCGCCCTGCCCAGGTGG + Exonic
1162907629 19:13833162-13833184 CCTGCCCACCCCTGACTGCAGGG + Intergenic
1163101690 19:15101195-15101217 CCTGCCTAGGCCTCCCTGGCTGG - Intergenic
1163105476 19:15120642-15120664 CCTGCCCAGCCCTCCCCTCAGGG + Intronic
1163727242 19:18929634-18929656 CCTGCCCACCCTTTCCTGGCAGG - Exonic
1163748354 19:19061123-19061145 CAAGCCCATCCCTGGCTGGAGGG - Intergenic
1163831209 19:19547994-19548016 CCTGCTCAGGGCTGCCTGGTGGG + Intergenic
1164201368 19:23021672-23021694 CCTGCCTGGCCCTGCCTACAAGG - Intergenic
1164527536 19:29022902-29022924 CCAGCCCTGTCCAGCCTGGAGGG + Intergenic
1164868520 19:31624960-31624982 CCTACCCAGCCCTTCTTGGAAGG + Intergenic
1165023221 19:32940514-32940536 CTTGCCCACCACTCCCTGGATGG + Intronic
1165100663 19:33436732-33436754 CCTGCCCACCCCTGCCTTCCGGG + Intronic
1165217042 19:34282439-34282461 CGTGCCCAGCCCTGCTTTTAAGG + Intronic
1165322392 19:35094097-35094119 CCTGCCCAGCCCAGCCCAGGTGG - Intergenic
1165752440 19:38268524-38268546 CCTGCCCAGCAGTCCCTGGCAGG + Intronic
1165789594 19:38483529-38483551 CCTGCCCACCCCTGCATAGCTGG - Intronic
1165832845 19:38737661-38737683 CCTGCCCGGCCCCACCTCGAGGG + Intronic
1165901342 19:39170676-39170698 GGTGCCCAGCCCAGCCTGGCGGG + Intronic
1166050407 19:40255750-40255772 CCTCCAAAGCCCTGCCTGGCTGG - Intronic
1166053489 19:40274923-40274945 CCTGCCCTGCCCTGGGTGCAAGG - Intronic
1166751288 19:45165074-45165096 CCTGCCCAGCCCTGCCAGCCAGG + Intronic
1167353585 19:48990775-48990797 TCTCCCCAGCTCTGCCTGGCTGG + Intronic
1167647026 19:50711474-50711496 CCTGCCCAGGCCTGCCAGCGGGG - Exonic
1167674800 19:50877533-50877555 CCTGCCCAGGCCTGGGAGGAGGG + Intronic
1167767910 19:51496624-51496646 CCTCCCCTTCCCGGCCTGGAGGG - Intronic
1167994953 19:53394859-53394881 AATGCAAAGCCCTGCCTGGATGG - Intronic
1168055805 19:53864547-53864569 CCTGCCCAGCCCAGGATGAAAGG - Intergenic
924999548 2:394048-394070 TCTGCCCAGCACCTCCTGGAGGG - Intergenic
926128555 2:10286355-10286377 GCTGCCCAGCCCTTCCTGCCCGG - Intergenic
926138266 2:10352703-10352725 CCTCCCCAGCTCTCCCTGGGGGG - Intronic
926251466 2:11157490-11157512 CCTTCCCAGCCTTGCCTGGGAGG + Intronic
927177743 2:20422258-20422280 CCTGCTCAGGCTCGCCTGGATGG + Intergenic
927200384 2:20574708-20574730 CTTGCCCAGCACTGCCTGCCCGG - Intronic
927490171 2:23516145-23516167 TCTGCCCTGCCCAGCCTGGCTGG + Intronic
927717539 2:25362209-25362231 CCTCCCTAGCCCTGCCGGGAAGG - Intergenic
927757353 2:25719691-25719713 CCTGCCCAGGCCTCTCTGGGAGG + Intergenic
927910084 2:26891364-26891386 CCAGCCCAGGCCTGCGTGAATGG + Intronic
928100878 2:28436854-28436876 CTGGCCCATCCCTGCCTGGGAGG - Intergenic
929549426 2:42880106-42880128 CCTGCCCGGACCAGCCTTGAGGG - Intergenic
929584586 2:43105802-43105824 CATGCCCAGCCATGCCCTGAAGG - Intergenic
929925302 2:46202421-46202443 CCTCCCCAGCCTTGGCCGGAGGG + Intergenic
931222904 2:60304443-60304465 CATGCCCAGCACTGGCTGAATGG + Intergenic
931430652 2:62206232-62206254 CCAGCCCAGAGCTGCATGGAGGG - Intronic
931464050 2:62471553-62471575 ACTCCCCAGCCCTACCTGCAAGG - Intergenic
931759315 2:65402568-65402590 CCTCTGCAGGCCTGCCTGGATGG - Intronic
932420130 2:71596654-71596676 ACTGCCCACCCCTACCTGGTGGG - Intronic
932493972 2:72137607-72137629 CCTGCCCTGCCCTGCCCCGTGGG + Intronic
933783908 2:85822947-85822969 GCTGACCCGCCCTGCCTGGAAGG - Intergenic
933942918 2:87260080-87260102 CCTCCCCAGCCCTTCAGGGAAGG + Intergenic
933995903 2:87669642-87669664 CCTGCCCATCCCAGGCTGGATGG - Intergenic
935321740 2:101896126-101896148 CTTCCCCAGCACTTCCTGGAAGG - Intergenic
935755225 2:106271305-106271327 CTTGCCCAGCTCTGACTGGAAGG + Intergenic
936087301 2:109477943-109477965 CCTGCCCTGCCTTTGCTGGAGGG + Intronic
936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG + Intergenic
936197736 2:110384821-110384843 CCAGCCCAGCACCACCTGGAAGG - Intergenic
936297953 2:111281270-111281292 CCTGCCCATCCCAGGCTGGATGG + Intergenic
936337296 2:111601482-111601504 CCTCCCCAGCCCTTCAGGGAAGG - Intergenic
936465879 2:112749827-112749849 CCTGCTCAGCTCTGCCAGCAGGG + Intronic
937206341 2:120239293-120239315 CCTCCCCAGCCCGGCATGGCTGG - Intergenic
937230825 2:120397164-120397186 CCTGCCCTGCCCTGCCCTGGGGG + Intergenic
937916001 2:127099016-127099038 CCTGCCCCGGCCACCCTGGAGGG - Intronic
937985293 2:127635597-127635619 CCTGCTCAGTCCGTCCTGGATGG + Intronic
938713797 2:134000400-134000422 CCTGCCATGTCCAGCCTGGATGG + Intergenic
938793767 2:134701465-134701487 CCTCCCCAGCTCTGCCCAGAAGG + Intronic
939839790 2:147173130-147173152 CCTGCCCAGCCCTGCCTTGCTGG + Intergenic
942946792 2:181681666-181681688 CCTGGCCAGCCCGCCCTGGACGG + Intergenic
946416830 2:219543990-219544012 GCAGCCCGCCCCTGCCTGGATGG + Exonic
947714728 2:232333779-232333801 GCTGCCCAGCCAGGCCTGGAAGG - Intronic
947734251 2:232446597-232446619 CTGGCCCACCCCTGCCTGGCTGG - Intergenic
947745770 2:232506594-232506616 CCAGCCTGGCCCTCCCTGGAGGG - Intergenic
947751973 2:232537705-232537727 TCTGCCCAGCCCTGCCTCCATGG + Intergenic
948192546 2:236071120-236071142 CCTGCCCAGTCGGGCTTGGAGGG + Intronic
948554255 2:238796394-238796416 CCTGCCCAGCACTGCCTGTGTGG + Intergenic
948823382 2:240561408-240561430 CAGGCCCAGTCCTGCCTGCAGGG + Exonic
948840411 2:240645968-240645990 CCTGCCAAAGCCTGCCAGGAAGG + Intergenic
948909024 2:240993800-240993822 CCAGCCCAGGCCTGCCTGCACGG + Intergenic
948980091 2:241490068-241490090 CCTGAGCAGCCCTGGATGGAGGG + Intronic
949028088 2:241775616-241775638 GCTGCCCAGCCGTGCCAGCAAGG + Intergenic
1168957053 20:1841626-1841648 GCTGCCCAGCCTTGCCTGGCAGG + Intergenic
1168958067 20:1848607-1848629 GCTGCCCTGGGCTGCCTGGAGGG - Intergenic
1169019768 20:2320954-2320976 ACTGCCCAGCCCTGCCAGGGAGG + Intronic
1170608901 20:17895495-17895517 CCTGCCCACCCCCACCTGGAAGG + Intergenic
1171767803 20:29299888-29299910 CCTCTCCAGCCCCGGCTGGAGGG - Intergenic
1172209599 20:33187412-33187434 CCTTCCCTGCCATTCCTGGAGGG - Intergenic
1172530176 20:35625639-35625661 CCAGCCCAGCTCTGCCCTGAGGG + Intergenic
1172649656 20:36493665-36493687 CCAGCCCAGCCCAGCGAGGAGGG + Intronic
1172777620 20:37416586-37416608 TCTGCCCAGCCCTGCCCCGTAGG - Intergenic
1172937890 20:38633709-38633731 CTTGCTCAGCACTGCCTGGAGGG - Intronic
1173182540 20:40815795-40815817 CCTGGAAAGCCCTGCCTGGGGGG - Intergenic
1173576963 20:44118476-44118498 CCTGCCCATCCTTCCCTGGCTGG + Intronic
1173646903 20:44639038-44639060 CCCGCACAGCCCTGCCTGGGTGG - Intronic
1173825827 20:46047166-46047188 CCTGGCCAGGCCTGTCTGGCAGG + Intronic
1174084026 20:47992332-47992354 CCTCTCCCTCCCTGCCTGGAAGG - Intergenic
1174287803 20:49484365-49484387 CCTGCCCGGCCCAGCCTGCCGGG + Intergenic
1174340655 20:49893059-49893081 CCAGGCCAGCCCTGCCTGCGAGG + Intergenic
1174708851 20:52684425-52684447 CATGCACAGCCGGGCCTGGAAGG - Intergenic
1174823883 20:53751268-53751290 TCAGCACAGCCCTGCCTGGCTGG - Intergenic
1175268023 20:57714283-57714305 CCACCCCCGGCCTGCCTGGACGG + Intergenic
1175281690 20:57808110-57808132 CCAGCCCAGGCCTGCCTGGCTGG - Intergenic
1175318666 20:58070208-58070230 GGTGCCCAGCCCTTTCTGGAGGG - Intergenic
1175382944 20:58576328-58576350 CCAGCCCAGAACTGCCTGGCAGG - Intergenic
1175623677 20:60472783-60472805 CCTGCCCAGCCTGGCCTGACTGG + Intergenic
1175987142 20:62769841-62769863 CTTGGCCAGCCCTGTCAGGATGG + Intergenic
1175997542 20:62818271-62818293 CCTGCCCAGCTCGGCCTCAATGG + Intronic
1176023730 20:62975386-62975408 CCTGCCCAGCACTCCCTGCCGGG - Intergenic
1176096086 20:63345250-63345272 CATCCCCACCCCTGGCTGGATGG + Exonic
1176239862 20:64070886-64070908 CTGGCCCAGCCCAGCCTGAACGG + Intronic
1176253335 20:64137670-64137692 CTTCCCCAGCCCTCCCTGTAGGG - Intergenic
1176302269 21:5104253-5104275 CCGGCCCAGCCCACCCTGGTGGG - Intergenic
1177024527 21:15905700-15905722 ACTCCACTGCCCTGCCTGGAGGG + Intergenic
1179180256 21:39038397-39038419 CCTGCCATGCCCAGCCTAGAAGG + Intergenic
1179429787 21:41312931-41312953 TCTGCCCTGCCCTTCCTTGAAGG - Intronic
1179430168 21:41316328-41316350 CCAGCCCAGCCCAGCCTAGCAGG - Intronic
1179613985 21:42569903-42569925 CCCGCCCAGCCCTGGGTGGCGGG + Intronic
1179777063 21:43671658-43671680 GCTGCCCAGCCCAGCTTAGATGG + Intronic
1179854758 21:44157669-44157691 CCGGCCCAGCCCACCCTGGTGGG + Intergenic
1179879691 21:44288222-44288244 CTTGGCCTGCCCTGGCTGGAAGG + Intronic
1180060491 21:45382567-45382589 CCTGCCCATCCCTGGCTGCAAGG - Intergenic
1180076335 21:45465180-45465202 CCTGCTCAGCCCCGACTGGCGGG + Intronic
1180084938 21:45504327-45504349 ACTGCCCAGCCCTGGCTCGGGGG + Intronic
1180147230 21:45928338-45928360 CCAGCCCAGACCTGGCTGCAAGG + Intronic
1180223846 21:46377233-46377255 CCTGCCCAGCACGGCCAGGAGGG - Intronic
1180625281 22:17190100-17190122 CTGGCCCAGCCCTGCACGGAGGG - Intronic
1180716121 22:17873542-17873564 CATGCCCAGCCCAGTCTAGAAGG - Intronic
1181013074 22:20053579-20053601 TCTGCCCAGCACTGCCTCGGGGG + Intronic
1181116785 22:20636511-20636533 CCTGGCCAGGCCTGGCTGGTGGG - Intergenic
1181270096 22:21653566-21653588 CCTGTCCAGCCATGACAGGATGG - Intronic
1181582335 22:23835180-23835202 CCTTCCCAGCCCTGCCTCCAAGG + Intronic
1182079797 22:27520852-27520874 CATGCCCAGCCATCCCTGGGAGG + Intergenic
1183191109 22:36322571-36322593 CCGAGCCTGCCCTGCCTGGAAGG + Intronic
1183192726 22:36332026-36332048 CCTGCCCTGCGTTGCCAGGATGG + Intronic
1183271476 22:36865215-36865237 GCTGCCAAGCCCTCCCTGCATGG + Intronic
1183307395 22:37089869-37089891 CCTGCCCAGCCCATCCTGCCTGG - Intronic
1183368897 22:37421404-37421426 ACTCTCCAGCCCTGCCTGGGAGG + Intronic
1183377949 22:37475931-37475953 CCTGCCTTGCCCTGGCTGGGAGG - Intronic
1183412156 22:37661155-37661177 CCTGCCCACACCTGCCTTGCAGG + Intronic
1183477877 22:38046054-38046076 CCTGCCCAGATGTGCCAGGATGG - Intergenic
1183617725 22:38955398-38955420 CCTGCCTTGCCCTGGCTGCAGGG + Intronic
1183675545 22:39297123-39297145 CTTCCCCAGCCCTGCCTGGCGGG - Intergenic
1183978059 22:41524601-41524623 CCGGCCCGGCCCTGCAGGGATGG + Intronic
1184777843 22:46632191-46632213 CCTTCCCAGCCCAGCCTCGTGGG - Intronic
1184962985 22:47945078-47945100 CCTGCCCCGCCCTCCCCTGAGGG - Intergenic
1185026511 22:48417309-48417331 CCTTCCCAGTCCTGAGTGGAGGG - Intergenic
1185050676 22:48552563-48552585 CATGCCCAGCTCTGCCTAAATGG + Intronic
1185176462 22:49330059-49330081 CCTGCTCACCCCTGCCTATAGGG - Intergenic
949918675 3:8984794-8984816 CCTGCCCCACCCTTCCTTGAGGG + Exonic
949937857 3:9130935-9130957 CATGCACAGCCCAGCCTGGGAGG - Intronic
950178758 3:10896089-10896111 CCTGCCCAGCCTTCACTGCAGGG - Intronic
950436047 3:12980803-12980825 ACTGTCCAGCCCTGCCTGCAGGG + Intronic
950451141 3:13066569-13066591 CCTGCCCAGCCCTGCCTGGAAGG - Intronic
950451199 3:13066793-13066815 CCAGGCCCGCCCTGCCTGCATGG - Intronic
950454069 3:13082375-13082397 CCTCCCCAGCCCTGACCTGAGGG - Intergenic
950501195 3:13365024-13365046 GCTCTCCAGCCCTCCCTGGAAGG + Intronic
950660934 3:14466680-14466702 CCGGCCCAGCCCTGGATGGGAGG - Intronic
950704761 3:14772935-14772957 CCAGCCCAGCCCTGCCTCCCCGG + Exonic
950707644 3:14792909-14792931 CCTGCTCTGCCCTGCCTGAGCGG + Intergenic
950764228 3:15261445-15261467 ACTGCCCAGCCCCTCCTGGCTGG + Intronic
950790398 3:15466995-15467017 CCTTCCCTGACCTTCCTGGATGG + Intronic
951902086 3:27666896-27666918 CCAGCCCGGCCCTGGCTGGTGGG - Intergenic
953023026 3:39127874-39127896 CTTGCCCAGCCCTGCAAGGTTGG - Intronic
953975692 3:47380446-47380468 CCTACTCAGCCCAGCCTGGGAGG - Intergenic
954361055 3:50123065-50123087 CCTGCCCAGCCTGTCCTGCAGGG + Intergenic
954389213 3:50260162-50260184 CGTGCTCTGCCCTGCCTGGCTGG + Intergenic
954583980 3:51718739-51718761 CAGACCCAGCCCTGCCTGGTGGG + Intergenic
954663196 3:52237095-52237117 CCTGCCCAGACCTTCCCAGAAGG + Intronic
954715334 3:52524010-52524032 CCAACCCAGCCCTACCTGGAAGG - Exonic
954900366 3:54014201-54014223 CCTCCCCAGCCAGGCTTGGAGGG - Intergenic
956614651 3:71158478-71158500 CCTGCTCACCCCTGCCTAAATGG - Intronic
957917872 3:86709163-86709185 CCTGCCGAGCCCGGCATGGGAGG + Intergenic
961362283 3:126375723-126375745 CCTACCCTGCCCTGCCCTGAGGG + Intergenic
961466180 3:127083004-127083026 CCTGCCCAGCACTGCATGCATGG + Intergenic
961471287 3:127114797-127114819 CCTGCCTCTCCCTGCCTGCATGG + Intergenic
961511906 3:127408550-127408572 CATGCCCTGCCCTGAGTGGACGG - Intergenic
961604351 3:128082719-128082741 CCTGCCCAGCACTGCCGGCCCGG + Intronic
961829405 3:129615806-129615828 CTTGCTGTGCCCTGCCTGGAAGG - Intergenic
962637433 3:137345556-137345578 CCTGCCCAGGGCTGTCTGGGAGG + Intergenic
962677906 3:137770050-137770072 CCTGCCCTGCCCTGCCTCCTAGG + Intergenic
963167993 3:142225000-142225022 CCTGTCCGGCCTTACCTGGATGG - Intronic
967100328 3:186210640-186210662 CCTGCCCCTCCCTGCCGGAAGGG - Intronic
968073467 3:195802496-195802518 CCTGCCCTGCCTGCCCTGGAAGG + Intronic
968449146 4:666996-667018 CCGACCCAGCCCCGCCTCGAGGG - Intronic
968598156 4:1495928-1495950 GCTGCCCTGCCCTGCCAGGGAGG + Intergenic
968939005 4:3628388-3628410 TCTGACCAGCTCTGTCTGGAAGG + Intergenic
969562227 4:7956592-7956614 CCTTCCCATCCCTTCCTGGCTGG + Intergenic
969618217 4:8265808-8265830 TCCACCCAGCCCTGCCAGGAGGG - Intergenic
970590956 4:17560408-17560430 ACTGGCCAGCCCTGTCTGGAAGG - Intergenic
971207416 4:24584098-24584120 GCTGCCCAGCCCAGTCCGGAGGG - Intronic
971377917 4:26069865-26069887 CCTGCCCACCTCTGCCTAGCTGG + Intergenic
973026925 4:45284410-45284432 TCGGCCCATCCCTGGCTGGAAGG + Intergenic
973773418 4:54226243-54226265 CGTGCCCTGCCCTGCCTCCAGGG - Intronic
974023432 4:56711535-56711557 TCTGGCCATCCCTGCCTTGAAGG - Intergenic
976420407 4:84836474-84836496 CCTCCTCTGCCCTGCCTGTAAGG - Intronic
976517100 4:85981731-85981753 CATGCAAAGCCCTGTCTGGAAGG + Intronic
978449720 4:108819274-108819296 CCAGGCCAGCCTGGCCTGGATGG - Exonic
981748020 4:148069381-148069403 CCAGCCCTCCCCTCCCTGGAAGG - Intronic
983247557 4:165305704-165305726 CCTGCCCTGCACCTCCTGGAAGG - Exonic
984314572 4:178111250-178111272 CCTTCCCAGCTCTTCTTGGATGG + Intergenic
985486914 5:156949-156971 CTTGGCCAGCCTGGCCTGGAGGG - Intronic
985558446 5:569529-569551 CCTGCGCAGTGCAGCCTGGACGG + Intergenic
985725138 5:1512142-1512164 CCTGCCAAGCCCTGTCCGGGTGG - Intronic
985757009 5:1725213-1725235 CCCGCCCGGGCCTGCCGGGAGGG - Intergenic
985826183 5:2193261-2193283 CCTCCTCAGCACTGCCAGGAGGG - Intergenic
986204574 5:5611287-5611309 CCAGGGCAGCCCTGACTGGATGG + Intergenic
989133769 5:38133283-38133305 CCTGCACAGCACTGCCTTGTCGG + Intergenic
990428786 5:55714132-55714154 CTTGACCAGCCCTGACTTGAAGG - Intronic
991463564 5:66884987-66885009 CCTGCACAGTCCTGCTTCGACGG + Intronic
992154262 5:73939496-73939518 CCTCCCCTCCCCTGCCTTGAGGG + Intronic
992941276 5:81764750-81764772 CCTGCACACCCCTGTTTGGATGG + Intergenic
994097254 5:95858300-95858322 CAGGGCCAGCCCTGCCTGGCTGG + Intronic
994314130 5:98312819-98312841 CCTGGGCAGCCCTGCCTTGGGGG - Intergenic
995708235 5:115007639-115007661 CATGACCAAACCTGCCTGGAAGG + Intergenic
997266356 5:132497224-132497246 CCTGCCCAGGCCTCTCCGGATGG + Intergenic
998207169 5:140166152-140166174 CCTCCCCTCCCCAGCCTGGAAGG - Intergenic
999736527 5:154517396-154517418 CCTGGGCACCCCTGCCTAGAGGG + Intergenic
1001568643 5:172716210-172716232 TCTGCCCAGCACTGCCAGGAAGG + Intergenic
1001570539 5:172727689-172727711 CCAGCTCTGCCCTGCCAGGAGGG - Intergenic
1001696732 5:173675762-173675784 CCTACCCAGGACTGCCTGGCAGG + Intergenic
1002059922 5:176620179-176620201 CCAGCCCAGCCCTGCCGGTGCGG + Exonic
1002080752 5:176736087-176736109 CCTGCCAAGCCCTGTATTGATGG - Intergenic
1002350182 5:178577608-178577630 CCTGCCCCCCGCTGCCTGGATGG + Intronic
1002480371 5:179497029-179497051 CCTGACCAGCTCAGTCTGGAGGG + Intergenic
1002540097 5:179900947-179900969 CAGGCCCAGCCTGGCCTGGAGGG - Intronic
1002570222 5:180135988-180136010 CCAGCCCAGCCCTTCTTGCACGG + Intronic
1003078209 6:3000407-3000429 GCTGCCCAGCGCTGCCCTGAAGG + Intronic
1003187894 6:3849146-3849168 CCTGCCCAGCCGTGGCTGGCCGG - Intergenic
1003405378 6:5823461-5823483 TCTGCCAGGCCCTGCCTGCAGGG - Intergenic
1003852239 6:10237037-10237059 CCTGCCCATTCCTGCCTTAATGG - Intergenic
1005307854 6:24530914-24530936 CCTGCCCACTCCTGCATGGGTGG + Intronic
1006145915 6:31959505-31959527 CCTGTCCATCCCAGCCTGAAGGG + Intronic
1006151617 6:31993003-31993025 CCTGCCCAGCCCTTCCTGCCCGG - Intronic
1006157918 6:32025741-32025763 CCTGCCCAGCCCTTCCTGCCCGG - Intronic
1006304701 6:33211925-33211947 CCTGCTTTGCCCAGCCTGGAGGG + Exonic
1006388770 6:33746725-33746747 CCTGCCCATCCCTGCCTACAAGG + Intronic
1007336531 6:41158831-41158853 CCTGCCCAGTCCACCCTTGATGG + Intronic
1007475671 6:42118318-42118340 CAAGCCCAGCCCTGCCTGCCTGG - Intronic
1007762000 6:44138753-44138775 CCTGCCCTGCCCCACCTTGAGGG + Intronic
1009292710 6:61904115-61904137 TCTCTCCAGCCCTGCCTAGAGGG + Intronic
1009800529 6:68531983-68532005 CCTGAGCAGCCCTGCCAGGGAGG + Intergenic
1010805322 6:80228905-80228927 CAAGCCCAGCTCTCCCTGGAAGG - Intronic
1012730210 6:102872322-102872344 CCTACTCATCCCAGCCTGGAGGG + Intergenic
1015325479 6:131918811-131918833 CCTGGCCAGACCTGCTTGCAGGG + Intergenic
1017041709 6:150313441-150313463 GCTGCCCTTCCCTGCCTGGATGG + Intergenic
1017545687 6:155449007-155449029 CATCCCCAGCCCTGCCTGACAGG - Intronic
1018047512 6:159978534-159978556 CCTCTCCAGGCCTCCCTGGAGGG + Intronic
1018632873 6:165835601-165835623 ACTGCAAAGCCCTCCCTGGAAGG - Intronic
1018731674 6:166656436-166656458 CCTCCCCTGCCCTGCCTGAGTGG + Intronic
1018797804 6:167200836-167200858 GGTGCCCAGCCCCTCCTGGAGGG - Intergenic
1019084089 6:169457927-169457949 GCTCCTCAGCTCTGCCTGGAAGG - Intronic
1019147200 6:169983094-169983116 CCTGCCCAGCCCCTCCTGGAAGG + Intergenic
1019162243 6:170076459-170076481 CCTGGCCTGGCCTGGCTGGAGGG - Intergenic
1019165875 6:170097324-170097346 CCTCTGCAGCCCTGCCAGGAGGG + Intergenic
1019346396 7:532924-532946 CCTTCCCAGGCCTGCCTGAGGGG + Intergenic
1019423723 7:963468-963490 TCTGCCCGGCCCTGTCTGGCAGG + Intronic
1019557327 7:1639189-1639211 CCTGCCCGGCCCTGCACAGATGG - Intergenic
1019587338 7:1812747-1812769 CCTGCCCAGCCCTGGCTGCCGGG - Intergenic
1019665428 7:2249836-2249858 CCTGCCCACCTCTGCCCGCAGGG + Exonic
1019699623 7:2468356-2468378 GGTCCCCAGCCCTGCCTGGGTGG + Intergenic
1019748905 7:2716658-2716680 CCTGGCCGTCCCTGCCTGGTGGG - Intronic
1020003036 7:4766361-4766383 TCTTCCCAGCACTGCCTGGAGGG - Exonic
1020014868 7:4825044-4825066 CCTACCCAGGCCTGTGTGGACGG + Intronic
1020092350 7:5348761-5348783 CCTGCCCCCGCCTGCCTGGCTGG - Intronic
1020100048 7:5389379-5389401 CCCTCCCACCCCTGCCTGGGCGG + Intronic
1020101693 7:5397462-5397484 GCTGCCCCGCCCAGCCTGGGAGG - Intronic
1022339488 7:29455059-29455081 CCTGCCTACCCCTGCCCTGAAGG - Intronic
1022563725 7:31375606-31375628 CCTGCTCAGCACTTCCTGGTAGG + Intergenic
1022675482 7:32495455-32495477 CTTGCCCAGCCCTGCCTCGCCGG + Intronic
1022840006 7:34155170-34155192 CCTGCTCTGCCCTGACAGGAGGG + Exonic
1022993006 7:35726712-35726734 CCTGCCCTGTGCTGCCTGGTGGG - Intergenic
1023684925 7:42724050-42724072 ATTACCCAGCCCTGCCTGGCCGG - Intergenic
1023769401 7:43541286-43541308 CCAACCCAGCCCTGTCTGCAGGG + Intronic
1023879228 7:44309047-44309069 CCTGCCCAGCACTGCCCGCCTGG + Intronic
1024241915 7:47442304-47442326 CCTACCTTGCCCTGACTGGAGGG - Intronic
1024243814 7:47454757-47454779 CCTGCCTGGCTCTGCCTGGCTGG - Intronic
1024556195 7:50605259-50605281 CCGGCCCTGGCCAGCCTGGAGGG - Intronic
1025026617 7:55521725-55521747 CCTGCCCTGCCCTGCCCTGTGGG - Intronic
1025262212 7:57426759-57426781 CATGCTCAGCCCAGCCTGGAGGG + Intergenic
1025615242 7:63112586-63112608 CCTGCTCAGCCCAGCCTGGAGGG - Intergenic
1025739562 7:64183987-64184009 CCTACTCAGCCCAGCCTGGCGGG + Intronic
1025928955 7:65980090-65980112 CCTGCCCTGCCCTGCCCTGGGGG - Intronic
1026000920 7:66558417-66558439 CCTGCTCAGCCCATCCTGGAGGG + Intergenic
1026087557 7:67275051-67275073 CGTGCCCAGCCCTCACTGTATGG - Intergenic
1026462833 7:70630042-70630064 GCTGCTCAGACATGCCTGGATGG - Intronic
1026726675 7:72875180-72875202 CATGCCCAGCCCTCACTGTATGG + Intergenic
1027117164 7:75490433-75490455 CGTGCCCAGCCCTCACTGTATGG - Intergenic
1027174171 7:75892881-75892903 CCTTCCCACCCCGGCCTGGGTGG - Intergenic
1027269805 7:76513156-76513178 CCTGCCCAGCGCTACCTTGGTGG - Intronic
1027274645 7:76545172-76545194 CGTGCCCAGCCCTCACTGTATGG + Intergenic
1027757366 7:82231170-82231192 CCTTTCCAGCCTTCCCTGGAAGG - Intronic
1028963723 7:96778272-96778294 CCTACCCAGGCCTGCCCAGAAGG - Intergenic
1029507511 7:100971320-100971342 CCTGTCCACCCCTGCCAGAAAGG - Intronic
1029720338 7:102359629-102359651 CGTGCCCAGCCCTCACTGTATGG + Intergenic
1029726285 7:102407723-102407745 CCTGACCAGCCATGCCAGAAGGG - Intronic
1029737698 7:102473763-102473785 CCCGCCAGGCCCTTCCTGGAGGG + Intronic
1032080768 7:128857371-128857393 GCAGCCCAGCCCAGCCTGGAGGG + Intronic
1032091485 7:128913789-128913811 GCAGCCCAGCCCAGCCTGGAGGG - Intergenic
1032194594 7:129781630-129781652 CGTGCCCATCCCTGGCTGCATGG - Intergenic
1033137763 7:138798789-138798811 CCTGCCTTGCCCTGCCAGGCCGG + Intronic
1033200078 7:139360464-139360486 CCTGCCGAGCCCTGATTGGATGG - Intronic
1033511613 7:142065323-142065345 CCTGCACGGCTCTGCTTGGAAGG - Exonic
1035628390 8:1090413-1090435 CCTGCCCTGCCTGGCCAGGAGGG - Intergenic
1035734260 8:1876370-1876392 CCTCCCCGGCCCTGCCCGGGTGG + Intronic
1037807981 8:22069084-22069106 CTTGCCCTGCCCTGCCCTGAAGG + Intronic
1037994026 8:23339903-23339925 CTGGCCCAGCCCTGCCTGGACGG - Intronic
1038761214 8:30385061-30385083 CCTGCCCGGCCCGGCGAGGAAGG + Exonic
1039983734 8:42430049-42430071 CCAGCCCAGGCTTACCTGGACGG + Exonic
1040570574 8:48605734-48605756 CCTCCACACTCCTGCCTGGATGG + Intergenic
1041397902 8:57410448-57410470 CCTGCCCATCACTTCCTGGTGGG - Intergenic
1045174378 8:99705954-99705976 CCTGCCCAGCCTTTCGTAGAGGG + Intronic
1045389696 8:101703361-101703383 TCAGCACAGCCCTGCCTTGAAGG + Intronic
1045507520 8:102789126-102789148 ACTGCACAGCCCAGCCTGAAGGG + Intergenic
1045828384 8:106428404-106428426 CATGGCCATCCCTGCCTGCAAGG + Intronic
1046611643 8:116432430-116432452 TCTGCCCAGCCCTACCTGCCTGG - Intergenic
1046772161 8:118126976-118126998 CTTCCCCTGCCCTGCCTGAAAGG + Intergenic
1047208403 8:122821243-122821265 GCTGCCCAGCCCTGCATGGACGG + Intronic
1047780740 8:128109108-128109130 CCAGCCCAGCACTGGCTCGAGGG - Intergenic
1049023199 8:139971418-139971440 CCTGCCCAGCTCCTCCTGGCCGG + Intronic
1049059056 8:140261875-140261897 CCTGCCCAACACAACCTGGAAGG + Intronic
1049094097 8:140538222-140538244 CTTGCACAGCCGTGCCTGTAGGG + Intronic
1049172524 8:141170642-141170664 CCCACCCCGCCCTGCCTGGCTGG - Intronic
1049211625 8:141389223-141389245 CCTGCCCAGCCCTGGAGGCATGG - Intergenic
1049300609 8:141867568-141867590 CCTGGCCATCCCTGACAGGAGGG + Intergenic
1049306040 8:141904828-141904850 CCTGCCCCTCCCTGCCTGGCAGG - Intergenic
1049436648 8:142589238-142589260 CCTGGCCAGCACTGCCCGGGGGG - Intergenic
1049690475 8:143956795-143956817 ACTGCCCAGCCCAGCCTGCCTGG + Intronic
1051910986 9:22154296-22154318 CCTGCTCAGCCCAGCCTGGAGGG + Intergenic
1051964014 9:22803769-22803791 CCTGCCCAGTTGTGTCTGGAAGG - Intergenic
1053455489 9:38230475-38230497 ACTGCCTATCCCTGCCTGGAAGG + Intergenic
1054451741 9:65406932-65406954 TCTGACCAGCTCTGTCTGGAAGG - Intergenic
1055364333 9:75527096-75527118 CCTCCCCAGCCCTGCCTCCTAGG - Intergenic
1056694429 9:88834098-88834120 TCAGCCAAGACCTGCCTGGAGGG - Intergenic
1056796703 9:89663491-89663513 CCTTCCCAGGCGGGCCTGGAGGG + Intergenic
1056840210 9:89992602-89992624 TCAGCACAGCCCTGGCTGGAAGG - Intergenic
1057026586 9:91738728-91738750 CCTGGCCACCGCTGCATGGACGG + Intronic
1057075427 9:92135901-92135923 GCTGCCCAGCCCAGCCTGCAGGG - Intergenic
1057199676 9:93133509-93133531 CTTGCCCTGCCCGGCCTGGGAGG - Intronic
1057218006 9:93240106-93240128 GCTGCCCACACCTGCCTGGATGG - Intronic
1057478640 9:95426795-95426817 CCGGCCCGGCCCTGCCTGCGCGG + Intergenic
1057596573 9:96419342-96419364 CCGCCCCAGCCCCGCCTGGCTGG + Intergenic
1057797516 9:98169405-98169427 CCTCCCCAGCCCTGCCCCCACGG + Intronic
1058715025 9:107715886-107715908 CCTGCCCAGCCAGGCCAGGGGGG + Intergenic
1058859105 9:109097070-109097092 CCTTCCCAGACCTCCCTGCATGG - Intronic
1059453713 9:114386921-114386943 CCTGGACAGCTCTGGCTGGATGG - Intronic
1059884346 9:118728611-118728633 CCTGCCTAGCCATGTCTGCATGG - Intergenic
1060139906 9:121201313-121201335 CCTGCCCAGCCGCGCCGAGAAGG + Intronic
1060191978 9:121599357-121599379 TCTGCCCAGTCCGGCCTGGGCGG + Intronic
1060915350 9:127385705-127385727 CCTCCCCAGCCCTGCCAGACTGG + Intronic
1061061925 9:128254743-128254765 CCTTTCCAAGCCTGCCTGGACGG + Exonic
1061192076 9:129087903-129087925 CCTGCCCTGCCCCGCCTGGCCGG + Intronic
1061418870 9:130462568-130462590 GCAGCCCAGCCGTGCCTGGCTGG + Intronic
1061422944 9:130481994-130482016 CCCTCCCAGCTCTCCCTGGAGGG - Intronic
1061590462 9:131594486-131594508 CCTGCCAAGCCCTGCTTGGCAGG + Intronic
1061665643 9:132159731-132159753 CCTCCCTAGCACTGCCAGGATGG - Intergenic
1061720211 9:132546693-132546715 TCTGTACTGCCCTGCCTGGAGGG - Intronic
1061842095 9:133364751-133364773 CCTGCTCACCCCTCCCTGGTTGG - Intronic
1062047598 9:134431685-134431707 CCTGCCTGGCCCTGCCCGGAGGG - Intronic
1062091561 9:134681153-134681175 CCACCCCAGCCCTCCCTGCAAGG - Intronic
1062099701 9:134721678-134721700 TCTTCTCAGCCCTGCCTGGAAGG + Intronic
1062167782 9:135116621-135116643 CCTCTCCTGACCTGCCTGGAGGG - Intronic
1062410091 9:136419220-136419242 CCTGCCCTGCCCTGCCCTGCCGG - Intronic
1062444480 9:136587930-136587952 CCAACCCAGCCCTGGCTGCAAGG + Intergenic
1062545881 9:137063615-137063637 CCTGCTCAGCCCAACCTGGAGGG - Exonic
1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG + Intronic
1062673308 9:137724274-137724296 CCACCCCCGCCCTGCCAGGAGGG + Intronic
1186521312 X:10209175-10209197 CATGCCCAGCCCTACCCAGACGG - Intronic
1189234470 X:39476846-39476868 CCTGCCCAGGCCAGCCAGCAGGG - Intergenic
1189369214 X:40414509-40414531 CCTGCTCTGCCCTGCAGGGAAGG - Intergenic
1189978470 X:46486187-46486209 CCTGCCGAGCCAGGCATGGAAGG + Intronic
1190151694 X:47955184-47955206 CCTTCGCAGCCCTGCCTGCTTGG + Intronic
1190161000 X:48031251-48031273 CCTTCGCAGCCCTGCCTGCTTGG - Intronic
1192167381 X:68834499-68834521 CCTGCCCACCCACGCCTGGGCGG + Intronic
1192205081 X:69090252-69090274 CCTTCCCAGCTATGCCTGGAGGG - Intergenic
1196833524 X:119794572-119794594 CCTGCCCACCCCTGCCCCAAGGG + Intergenic
1196938081 X:120749446-120749468 ACAGCCCAGCCCTGCCTGGCTGG + Intergenic
1199952712 X:152718005-152718027 CCTACCCACCCCTGCATGAACGG + Exonic
1199955311 X:152737060-152737082 CCTACCCACCCCTGCATGAATGG + Exonic
1199956971 X:152750443-152750465 CCTACCCACCCCTGCATGAACGG - Intronic
1199991880 X:152992036-152992058 CCTGCCCTCTTCTGCCTGGAGGG - Exonic
1200083884 X:153593346-153593368 CCACCCCAGCCCTGACTGGAAGG + Intronic
1200103302 X:153699168-153699190 CTTGCCCAGCCTAGACTGGAGGG - Intergenic
1200119292 X:153782897-153782919 GCTGCCCAGCCTGGCCTGGGCGG + Intronic
1200128304 X:153828568-153828590 CCTGCCGAGGCCTTCCCGGAGGG + Intronic
1201742668 Y:17341159-17341181 CCTCCCCTGTGCTGCCTGGAAGG + Intergenic