ID: 950452050 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:13071045-13071067 |
| Sequence | TCCGGATGATTTTAATGTCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 106 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 96} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 950452050_950452052 | -3 | Left | 950452050 | 3:13071045-13071067 | CCTGGACATTAAAATCATCCGGA | 0: 1 1: 0 2: 0 3: 9 4: 96 |
||
| Right | 950452052 | 3:13071065-13071087 | GGAAAATGAAAAAGATCCTGAGG | 0: 1 1: 0 2: 1 3: 63 4: 530 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 950452050 | Original CRISPR | TCCGGATGATTTTAATGTCC AGG (reversed) | Intronic | ||