ID: 950452050

View in Genome Browser
Species Human (GRCh38)
Location 3:13071045-13071067
Sequence TCCGGATGATTTTAATGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950452050_950452052 -3 Left 950452050 3:13071045-13071067 CCTGGACATTAAAATCATCCGGA 0: 1
1: 0
2: 0
3: 9
4: 96
Right 950452052 3:13071065-13071087 GGAAAATGAAAAAGATCCTGAGG 0: 1
1: 0
2: 1
3: 63
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950452050 Original CRISPR TCCGGATGATTTTAATGTCC AGG (reversed) Intronic