ID: 950452566

View in Genome Browser
Species Human (GRCh38)
Location 3:13073420-13073442
Sequence CGCAGCATCCGGAGAAGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950452560_950452566 -9 Left 950452560 3:13073406-13073428 CCCGGGTTTGCTCTCGCAGCATC 0: 1
1: 0
2: 1
3: 4
4: 110
Right 950452566 3:13073420-13073442 CGCAGCATCCGGAGAAGGGGCGG 0: 1
1: 0
2: 0
3: 16
4: 137
950452561_950452566 -10 Left 950452561 3:13073407-13073429 CCGGGTTTGCTCTCGCAGCATCC 0: 1
1: 0
2: 1
3: 4
4: 81
Right 950452566 3:13073420-13073442 CGCAGCATCCGGAGAAGGGGCGG 0: 1
1: 0
2: 0
3: 16
4: 137
950452559_950452566 -8 Left 950452559 3:13073405-13073427 CCCCGGGTTTGCTCTCGCAGCAT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 950452566 3:13073420-13073442 CGCAGCATCCGGAGAAGGGGCGG 0: 1
1: 0
2: 0
3: 16
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950452566 Original CRISPR CGCAGCATCCGGAGAAGGGG CGG Intergenic
901026512 1:6281281-6281303 CGCAGCCTGTGGAGAAGGGAGGG + Exonic
902522668 1:17029546-17029568 CTCAGCCTCCTGAGTAGGGGTGG + Intronic
902623195 1:17662340-17662362 TGCAACATCCGGAGAAGGGCAGG + Intronic
903642667 1:24870714-24870736 AGCAGCACCCGGAGCAGTGGTGG + Intergenic
903950457 1:26993515-26993537 AGCAGAATCCGGCGAAGGGCAGG + Intergenic
904599884 1:31667482-31667504 GGCAGCAGCCTGTGAAGGGGAGG - Intronic
905688555 1:39926362-39926384 CGCAAGATCTGTAGAAGGGGAGG - Intergenic
905862556 1:41361241-41361263 CGCCGCCTACGGAGCAGGGGCGG - Intergenic
907357712 1:53889916-53889938 CTCAGCCTCGGGAGAAGGGCGGG - Intergenic
908224239 1:62040051-62040073 GGGAGCATCTGGTGAAGGGGAGG + Intronic
911647674 1:100353073-100353095 GGCAGCCTCAGGAGAAGGTGGGG - Intronic
921152662 1:212414498-212414520 CGCAGCATACGGAGAACGCTGGG + Intronic
922204842 1:223437188-223437210 CCCAGCCTCCTGGGAAGGGGTGG - Intergenic
1063106514 10:2997074-2997096 AGCAGCCTGGGGAGAAGGGGAGG + Intergenic
1069726768 10:70585301-70585323 CTCAGCCTCCGGAGAGAGGGCGG + Intergenic
1072415666 10:95244814-95244836 CGCTGCAACCTGAGAAGCGGAGG + Intronic
1073049193 10:100656702-100656724 CGCAGCGGCGGGCGAAGGGGCGG + Intergenic
1073511137 10:104043268-104043290 CTCAGCATTTAGAGAAGGGGAGG - Intronic
1076837127 10:133026808-133026830 CGCAGCATCCTGAGAGAGGGGGG + Intergenic
1077428260 11:2498290-2498312 CAGAGCACCTGGAGAAGGGGTGG - Intronic
1077797482 11:5507760-5507782 TGCAGCATATGGAGAAAGGGAGG + Exonic
1079152498 11:17913160-17913182 CGCAGCATCTGGCCAAGGGCAGG + Intronic
1080682244 11:34487667-34487689 AGCAGCATCAGCAGAAGGAGGGG - Intronic
1083227404 11:61293955-61293977 GGCAGCAGCCTGAGAAGGAGGGG + Intronic
1083859327 11:65411581-65411603 CCCAGCATCCGGGGGAAGGGAGG - Exonic
1083883082 11:65557967-65557989 CGCAGGACCCGGGGGAGGGGGGG + Exonic
1084598968 11:70133632-70133654 TGCAGCCTCCGGAGCAGGGGAGG - Intronic
1086120504 11:83300582-83300604 CCCATCATCTGGGGAAGGGGGGG - Intergenic
1087564832 11:99841620-99841642 AGCAGCATCAGCAGAAGAGGAGG + Intronic
1087912632 11:103771244-103771266 TGCAGCATCTTGAGAAGGTGGGG + Intergenic
1090804870 11:130196555-130196577 CGCAGTATCTGGAGGGGGGGCGG - Exonic
1091277419 11:134361946-134361968 CGCAGCAGCACGAGAAGGGGAGG - Intronic
1094495088 12:30984209-30984231 AGCACCATCTAGAGAAGGGGAGG + Intronic
1094843099 12:34350115-34350137 CCCTGCATGCGCAGAAGGGGCGG + Intergenic
1098360614 12:69650993-69651015 CTCAGCCTCCGGAGAAGCTGGGG - Intronic
1106614149 13:31310831-31310853 GCCAGCATCTGGACAAGGGGTGG - Intronic
1106641396 13:31587860-31587882 GGCTGCATCCTCAGAAGGGGAGG - Intergenic
1108827505 13:54432573-54432595 CGCAGGATGTGGATAAGGGGAGG + Intergenic
1113803286 13:113097193-113097215 AGCTGCTTCCGGAGAAGTGGAGG + Intronic
1119301102 14:73571595-73571617 TGCAGCTCCCTGAGAAGGGGCGG + Intronic
1119388707 14:74275754-74275776 CGCAGCTTCCAGAGAAGAGTGGG - Intergenic
1122659832 14:103287809-103287831 CGCCGAATCCGGAGGAGGTGGGG + Intergenic
1122889395 14:104725417-104725439 CACAGAACCCGGAGAAGGGACGG - Intronic
1124657807 15:31523235-31523257 GACAGCAGCCAGAGAAGGGGAGG - Intronic
1125300806 15:38252407-38252429 GGCAGGATCCCGAGAAGCGGCGG - Exonic
1125351418 15:38771181-38771203 TGCAGCACCCACAGAAGGGGTGG - Intergenic
1125760783 15:42094236-42094258 AGCAGCATCCGTAGATGCGGGGG - Intronic
1127270976 15:57401852-57401874 CCCATCAACAGGAGAAGGGGAGG - Intronic
1128613022 15:69088914-69088936 GGCAACATAAGGAGAAGGGGAGG - Intergenic
1129428438 15:75481370-75481392 CGCCCCATCCGGAGGAGGTGGGG + Intronic
1132807702 16:1782628-1782650 CGGAGCTTCGGGAGAGGGGGCGG + Exonic
1136145341 16:28313176-28313198 CTCAGCCTCCTGAGAAGGTGGGG - Intronic
1136498776 16:30659481-30659503 CGCCGCATCCGGAGGCGGCGGGG - Exonic
1136505180 16:30698552-30698574 CGCAGCACCCCGGGAAGGTGGGG - Intronic
1139340183 16:66263371-66263393 CTCAGCCTCCAGAGATGGGGGGG + Intergenic
1146559552 17:33856548-33856570 AGCAGCATCAGTAGAAGTGGTGG + Intronic
1147000528 17:37359118-37359140 CCCGGCACACGGAGAAGGGGCGG + Intronic
1148331922 17:46818456-46818478 CGCCGCGTCCGGGGAAGGTGGGG - Intronic
1150416907 17:64995405-64995427 CGCAGCCTCCCGAGGAGGGGAGG + Intergenic
1150794761 17:68228520-68228542 CGCAGCCTCCCAAGGAGGGGAGG - Intergenic
1152204976 17:78969817-78969839 CGCAGGATCTGGAGGTGGGGGGG + Intergenic
1152701067 17:81819954-81819976 CGGTGCATCGGGTGAAGGGGTGG + Intergenic
1157662709 18:49460134-49460156 CGGTGCTTCCGGAGATGGGGCGG - Intronic
1158976479 18:62715641-62715663 CGCTGCCTCCGGAGCTGGGGGGG + Exonic
1160814319 19:1028237-1028259 GGCGGCTTCCGGAGACGGGGTGG + Intronic
1160992109 19:1864144-1864166 GGAAGCATCCGGGGAGGGGGCGG - Intergenic
1161030517 19:2056017-2056039 AGTGGCCTCCGGAGAAGGGGAGG + Intergenic
1161114289 19:2488255-2488277 AGCTGCATCTGGAGAAGGGGTGG + Intergenic
1161683419 19:5691747-5691769 GGCAGCACCCGGAGAGGGTGTGG - Intronic
1161849759 19:6732230-6732252 AGCAGCCTCCGGAGCAGGGCGGG - Intronic
1163616780 19:18333806-18333828 CTCAGCCTCCGGAGTAGGTGGGG - Intergenic
1165065275 19:33225017-33225039 CGCAGCCTGCGCAGAAGGGACGG - Intronic
1165074314 19:33272464-33272486 GGCTGCACCTGGAGAAGGGGAGG + Intergenic
1165871406 19:38975795-38975817 CCCCGCAGCCGGAGGAGGGGCGG - Exonic
1166103406 19:40584736-40584758 CTCAGCTTCCTGAGTAGGGGAGG + Intronic
1167045312 19:47045900-47045922 CTCTGCATCTGGAGGAGGGGAGG + Exonic
1168266416 19:55226142-55226164 TGCAGTATCGGGAGAAGGGTGGG - Intergenic
1168594503 19:57664447-57664469 CGCAGCACCCGGGGCGGGGGAGG + Intergenic
926796278 2:16621699-16621721 GGCAGCATCTGGAGAAAGTGAGG - Intronic
927275960 2:21262696-21262718 CGCAGCAGCAGGACAAGAGGGGG + Intergenic
927836370 2:26402179-26402201 CGCAGGAGCCGGAGAAGGGCTGG + Intronic
928774353 2:34740521-34740543 AGCAGCATCAGGAGAAGAGGAGG + Intergenic
930665527 2:54095965-54095987 CGCCCCATCCGGAGGAGGTGGGG - Intronic
935331554 2:101981126-101981148 CCCAGCACCCCGAGATGGGGGGG + Intergenic
935899065 2:107771016-107771038 CCCAGCATCCTGAGAAAAGGTGG - Intergenic
943400403 2:187402756-187402778 GGCAGCATCCTGAGAAGGAATGG + Intronic
948624563 2:239261130-239261152 CTCAGCCTCCTGAGATGGGGTGG + Intronic
948734074 2:239987700-239987722 CGCAGCGCCCAGGGAAGGGGTGG + Intronic
1172126317 20:32627133-32627155 CCCGGCCTCCGGGGAAGGGGTGG + Intergenic
1172913758 20:38428936-38428958 CTCAGAATCCTGTGAAGGGGTGG + Intergenic
1176061491 20:63174750-63174772 TGCAGCATGCGGAGGTGGGGAGG - Intergenic
1176200468 20:63858135-63858157 CGCAGGGTCAGGAGAAGGGGCGG - Intergenic
1177835244 21:26180282-26180304 CTCAGCCTCCTGAGTAGGGGTGG + Intergenic
1180200112 21:46219169-46219191 CTCAGCATCTGTAGAAGTGGGGG - Intronic
1180259770 21:46661433-46661455 CGCCGCGTCTGGAGATGGGGCGG + Intronic
1183090621 22:35519576-35519598 GGCAGCATCCAGTTAAGGGGAGG + Intergenic
1183942233 22:41302241-41302263 CGCAGCACCCGGAGTTGGAGGGG + Intronic
1184678192 22:46054557-46054579 CGCAGCACCTGCAGCAGGGGTGG + Intronic
1184759100 22:46534946-46534968 CTCAGCAGCCAGAGAGGGGGCGG - Exonic
950452566 3:13073420-13073442 CGCAGCATCCGGAGAAGGGGCGG + Intergenic
951832214 3:26943129-26943151 CAGAGCATCAGGGGAAGGGGTGG + Intergenic
952534550 3:34296046-34296068 AGCAGTCTCAGGAGAAGGGGAGG + Intergenic
957474888 3:80709969-80709991 CACAGCACCAGGGGAAGGGGTGG + Intergenic
958432854 3:94062746-94062768 CTCAGCATCCGCAGAAGCAGGGG + Intronic
967231209 3:187338979-187339001 CACAGCAGCCTGAGAAGGGATGG + Intergenic
968746532 4:2363318-2363340 CGCGGCATCCAGAGATAGGGAGG + Intronic
968756084 4:2417353-2417375 CGCTGCAGCCGGAGCAGGGCCGG - Intronic
983623418 4:169783012-169783034 TGCAACATCCGGGGCAGGGGAGG + Intergenic
986015069 5:3750676-3750698 CGCAGCACCCTGAGATAGGGTGG + Intergenic
987307419 5:16650357-16650379 TGCAGAATCAGGAGAAGGGGAGG + Intergenic
995552158 5:113292701-113292723 CGCAGACTTAGGAGAAGGGGGGG - Intronic
998169611 5:139864807-139864829 GGCAGCCTTCGGAGCAGGGGAGG + Intronic
998367946 5:141643081-141643103 GGCAGCATCTGGAGGTGGGGTGG + Exonic
1000201073 5:159011680-159011702 CGCAGCAGTCAGAGAAGGGGGGG - Intronic
1001438713 5:171721201-171721223 CCCAGCAGCCGAAGTAGGGGTGG + Intergenic
1003824048 6:9932525-9932547 CTCAGCATCCGGAGTTGGGGTGG + Intronic
1006414474 6:33895315-33895337 CACAGCATCCAGGGAAGGAGGGG - Intergenic
1006575420 6:35041771-35041793 CTCAGCATCTGAAGAAAGGGTGG - Intronic
1006939170 6:37740307-37740329 TGCAGCATCCTGAGAAAAGGAGG + Intergenic
1008630531 6:53359506-53359528 CGCCGCATCTGGCGATGGGGCGG + Intergenic
1010204976 6:73314723-73314745 CGCAGGTTCCCGAGAAGGGCGGG - Intergenic
1010326279 6:74566444-74566466 CTCAGCATCTGGAGATGGGATGG - Intergenic
1011316433 6:86036684-86036706 CTCAGCCTCCGGAGAAGCTGGGG - Intergenic
1012544694 6:100404668-100404690 GGAAGCATCCCGAGAAGTGGGGG - Intronic
1013512273 6:110855961-110855983 CGCAGCCTCCGGAGTAGCTGGGG - Intronic
1015840109 6:137467837-137467859 TGCAGCATCCTGGGATGGGGAGG - Intergenic
1020213705 7:6173046-6173068 AGCAGCATCCGGGGGAGAGGAGG - Intronic
1024937583 7:54726987-54727009 CGCAGCATCGGCAGGAGGGAAGG - Intergenic
1033732739 7:144195387-144195409 CGCAGGCTCCGGAAATGGGGGGG - Intronic
1033743590 7:144293967-144293989 CGCAGGCTCCGGAAATGGGGGGG - Intergenic
1033750312 7:144355630-144355652 CGCAGGCTCCGGAAATGGGGGGG + Intronic
1035338506 7:158145367-158145389 CACATCATCGTGAGAAGGGGCGG + Intronic
1036581115 8:10076798-10076820 GGTAGCATCAGGAGAAGGGAGGG + Intronic
1037410391 8:18589660-18589682 GGCAGGGTCTGGAGAAGGGGTGG + Intronic
1038828581 8:31033265-31033287 CGCAGCGGCCGCAGGAGGGGCGG - Exonic
1040294612 8:46142770-46142792 CCCAGGATTCGGAGAAGGGTGGG - Intergenic
1042871151 8:73400832-73400854 CACTGCACACGGAGAAGGGGTGG + Intergenic
1045852084 8:106713964-106713986 AGCAGCAGCCAGAGAATGGGAGG + Exonic
1049685353 8:143937225-143937247 CACAGCCCCGGGAGAAGGGGAGG - Exonic
1049850418 8:144827441-144827463 CCCAGGCTCCGGAGAAGGGGTGG - Intergenic
1053240070 9:36487825-36487847 CGCCGCTCCCTGAGAAGGGGAGG + Intergenic
1057499436 9:95585068-95585090 GGCATCATCAGGAGCAGGGGTGG + Intergenic
1058817648 9:108699892-108699914 CACAGCATTCGGAGAATGGCAGG + Intergenic
1059419353 9:114181358-114181380 CGGTGCATTCGGAGAAGGGGAGG + Intronic
1061266954 9:129511683-129511705 CTCAGCTTCCAGGGAAGGGGAGG + Intergenic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062512461 9:136914315-136914337 CGCAGCATGCTGGGAATGGGGGG - Intronic
1185761190 X:2691060-2691082 GGCAGTTTCCTGAGAAGGGGCGG + Intergenic
1187506241 X:19880721-19880743 CCAGGCATCCTGAGAAGGGGAGG + Intronic
1188285591 X:28322532-28322554 TGCCGGATCCGGAGGAGGGGTGG - Intergenic
1190064962 X:47233389-47233411 CGCAACGTCTGGAAAAGGGGCGG + Intronic
1191842832 X:65525157-65525179 AGCAGCATAGGGAGGAGGGGTGG + Intronic
1191846365 X:65550648-65550670 CCCAGCATCCGGGGAAAGGGGGG + Intergenic
1195702646 X:107716556-107716578 TGCAGCATCCTGGGAAGGGGCGG - Intronic