ID: 950452778

View in Genome Browser
Species Human (GRCh38)
Location 3:13074538-13074560
Sequence TCCTCAAGACAACCCCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950452773_950452778 27 Left 950452773 3:13074488-13074510 CCCAGACCTATCTCAGAGGCATG 0: 1
1: 0
2: 2
3: 9
4: 142
Right 950452778 3:13074538-13074560 TCCTCAAGACAACCCCAATGAGG 0: 1
1: 0
2: 4
3: 17
4: 144
950452774_950452778 26 Left 950452774 3:13074489-13074511 CCAGACCTATCTCAGAGGCATGT 0: 1
1: 0
2: 0
3: 10
4: 116
Right 950452778 3:13074538-13074560 TCCTCAAGACAACCCCAATGAGG 0: 1
1: 0
2: 4
3: 17
4: 144
950452775_950452778 21 Left 950452775 3:13074494-13074516 CCTATCTCAGAGGCATGTAGATA 0: 1
1: 0
2: 1
3: 8
4: 166
Right 950452778 3:13074538-13074560 TCCTCAAGACAACCCCAATGAGG 0: 1
1: 0
2: 4
3: 17
4: 144
950452777_950452778 -10 Left 950452777 3:13074525-13074547 CCGTGCACGGTAATCCTCAAGAC 0: 1
1: 0
2: 0
3: 1
4: 49
Right 950452778 3:13074538-13074560 TCCTCAAGACAACCCCAATGAGG 0: 1
1: 0
2: 4
3: 17
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950452778 Original CRISPR TCCTCAAGACAACCCCAATG AGG Intergenic
902034306 1:13445709-13445731 TCCTCAGGACTTCCCCATTGAGG - Intergenic
903577073 1:24345639-24345661 TCCCCAACACACCCCCACTGGGG + Intronic
904453958 1:30635822-30635844 TCCTCAACAGATCCCCAAAGAGG + Intergenic
906764822 1:48419177-48419199 TCCTCAAAACAACCCTAACAAGG + Intronic
908316321 1:62936313-62936335 TCCTCAAAACATCCACAAAGGGG - Intergenic
909000665 1:70213729-70213751 TCCTCATAACAACCCCAATGAGG + Intronic
913701688 1:121380597-121380619 TCCTCATAATAACCCCAATGAGG - Intronic
914042249 1:144061066-144061088 TCCTCATAATAACCCCAATGAGG - Intergenic
914135841 1:144899422-144899444 TCCTCATAATAACCCCAATGAGG + Intronic
917256418 1:173121090-173121112 TCCTGAAGACTAGCCCAGTGGGG + Intergenic
917594566 1:176516091-176516113 TTCTCAAGACACCCACAATTGGG + Intronic
920119594 1:203646178-203646200 TCCTCATGACAATCCTAATAAGG + Intronic
920489112 1:206399317-206399339 TCCTCATAATAACCCCAATGAGG - Intronic
921050750 1:211509572-211509594 TCCTCCAGACCTGCCCAATGCGG + Intergenic
921165639 1:212504928-212504950 TCCTCATGACAACCCCAAGAGGG + Intergenic
921597071 1:217066007-217066029 TCCTCAAAGCAACGCCACTGGGG - Intronic
923291356 1:232549133-232549155 TCCTCCACACAACCCAAGTGAGG + Intronic
1063986358 10:11507821-11507843 TCCTCACAACAAGCCTAATGGGG + Intronic
1064665940 10:17651294-17651316 TCCTCAAAACAAACCTACTGAGG - Intronic
1065861103 10:29872959-29872981 GCTACAAGACAACCCCAAAGGGG - Intergenic
1067878776 10:50025998-50026020 TTCTCATGAGAACCCCACTGAGG + Intergenic
1073171875 10:101517570-101517592 TACTTAAGGCAACCCAAATGTGG - Intronic
1073692359 10:105823732-105823754 TTCTCAAGGCATCCCCATTGAGG - Intergenic
1074855704 10:117471918-117471940 TCCTCACAACCACCCCAATGAGG - Intergenic
1076081950 10:127590327-127590349 TCTTCAAACCAACCCCAGTGAGG - Intergenic
1077114130 11:875424-875446 TCCTGAGCACATCCCCAATGGGG - Intronic
1077846663 11:6032638-6032660 TCCACCAGACAACCCCCCTGTGG - Intergenic
1087094705 11:94307578-94307600 TGCTCAGGGCAACCCCAATGTGG + Intronic
1094638541 12:32250318-32250340 TCCTCACAATAACCCCACTGAGG - Intronic
1094796483 12:33979256-33979278 TCCTGATAACAACCCCAAGGTGG + Intergenic
1098169260 12:67729818-67729840 TCCTCAAGATATCCTCAAGGTGG + Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102084115 12:110122342-110122364 TCCTCATGTCAACCCTATTGAGG + Intergenic
1102590356 12:113951911-113951933 TTCTCAAGAGAACCACACTGAGG - Intronic
1108231521 13:48348346-48348368 TCTTCAATACTACTCCAATGAGG - Intronic
1108741888 13:53346804-53346826 TCCTGAATGCAACCCCAGTGTGG + Intergenic
1110066070 13:71107067-71107089 ACCTCAAGAAAACCCAGATGTGG + Intergenic
1111643714 13:91003407-91003429 CCCTCACAACAACCCTAATGTGG - Intergenic
1115136982 14:30122058-30122080 TCCTCATAACAACCCTAAAGGGG + Intronic
1115336401 14:32247475-32247497 TCCCCAGGTCAACCCCAATTGGG - Intergenic
1115449702 14:33532397-33532419 TGCTGAAGAGAACCCCAAAGAGG - Intronic
1115956996 14:38792372-38792394 TCCACAGGGCAACCCCAAGGAGG + Intergenic
1119447230 14:74676020-74676042 TCCACAGGACAAGCCAAATGTGG + Intronic
1120110003 14:80542745-80542767 TCCTCAAGACACCCTCAAGTAGG + Intronic
1121085808 14:91145318-91145340 TCCTGGAGAAAACCCCAATGTGG - Intronic
1121501777 14:94443749-94443771 TCCTCACAACAGCCCCAAGGAGG - Intronic
1122079476 14:99257020-99257042 TCCTCACAGCAACCCTAATGAGG + Intronic
1125137651 15:36362724-36362746 CCATCAACACACCCCCAATGAGG - Intergenic
1128911374 15:71518638-71518660 TCCTCATGACAACCCTGATGAGG + Intronic
1130384072 15:83396153-83396175 TACTGAATACAACTCCAATGGGG + Intergenic
1131159209 15:90093556-90093578 TCCCAAAAACAACCCCAAGGAGG + Intronic
1135039555 16:19107543-19107565 TGCTCAGAACAAGCCCAATGAGG - Intergenic
1138793324 16:59935663-59935685 TCTTCAAGACAAACTCAATCTGG + Intergenic
1141253866 16:82382998-82383020 TCCTCAAGGCAACCCCCGAGGGG + Intergenic
1141254571 16:82388719-82388741 TCCTCAAAACAATCCCATGGAGG - Intergenic
1141617229 16:85216916-85216938 TCCTCAAGAGAACCCAAAGAGGG - Intergenic
1145798684 17:27670230-27670252 GCCACAGGACAACCCCAGTGAGG + Intergenic
1148255589 17:46128745-46128767 TGATAAAGACAACACCAATGAGG + Intronic
1149519111 17:57304879-57304901 TCCTTAAGAAAACCCCTCTGTGG - Intronic
1153699487 18:7678191-7678213 TTCTCAAGGCAACCCCTTTGTGG - Intronic
1154276485 18:12965855-12965877 TACACTAGACAACCCCAAGGTGG - Intronic
1156189032 18:34697318-34697340 TCCTCAAGCCAACTCCTGTGAGG + Intronic
1158260944 18:55605031-55605053 TCCTCAACAGGACCCCAGTGAGG - Intronic
1164929945 19:32167638-32167660 TCCTCAAGACTACTCGAATAGGG - Intergenic
1165070216 19:33251304-33251326 TCCTCAGGGCAGCCCCAAGGAGG - Intergenic
1165570641 19:36772165-36772187 TCTTCAGGACAACCCCCCTGTGG + Intronic
1168615940 19:57837186-57837208 TCCACAATCCAACCCCCATGTGG + Intronic
1168620834 19:57878238-57878260 TCCACAATGCAACCCCCATGTGG - Intronic
925860933 2:8174512-8174534 TCCTCAAGACAACCCCAGTCAGG - Intergenic
932148681 2:69347800-69347822 TCCTCAAAACAACCTTAATGAGG + Intronic
935685725 2:105680932-105680954 TCCAAAATACAACCACAATGGGG - Intergenic
938912849 2:135901345-135901367 ACCTCAATACCACCACAATGGGG - Intergenic
939139912 2:138342734-138342756 TACTCAAGATAACCCTGATGTGG + Intergenic
940063216 2:149596112-149596134 TCCTCTTGACAACCCTTATGTGG - Intergenic
942237579 2:173927125-173927147 TCACCAAGACAACACCAAGGAGG + Intronic
943684234 2:190800172-190800194 TCATTAAGAAAACCCAAATGAGG - Intergenic
944919811 2:204401031-204401053 CCCTGAAGACATCACCAATGTGG + Intergenic
946964166 2:225019479-225019501 TCCTCAAGCCAACCCTACTTTGG + Intronic
948388254 2:237595019-237595041 TCCGCAAGAAAACCCCAAGGAGG - Exonic
948854919 2:240725572-240725594 CCCTCGAGAAAACCCCACTGGGG + Intronic
1169689474 20:8314586-8314608 TCCTCAAAACAACCCTCATTTGG - Intronic
1173634967 20:44547505-44547527 TCCTCAAGACAACTCCTATGAGG - Intronic
1174526578 20:51176565-51176587 TTCTCAGAACAACCCCTATGAGG - Intergenic
1174824902 20:53760152-53760174 ACCTCAAGACTTCCCCAAAGTGG + Intergenic
1177735300 21:25081718-25081740 TCATCAAGACAATACCAAGGAGG + Intergenic
1178808728 21:35861384-35861406 TCCTCAGGACAAATTCAATGAGG - Intronic
950086317 3:10260556-10260578 CCCTCAAGAGAAACCCAGTGAGG + Exonic
950452778 3:13074538-13074560 TCCTCAAGACAACCCCAATGAGG + Intergenic
953004818 3:38968410-38968432 CCCTAAAGAAAACCCTAATGGGG + Intergenic
953133996 3:40167152-40167174 TCCTCAGGACAAGCAAAATGAGG + Exonic
955791105 3:62589623-62589645 CTCTCAAGACAACCCTACTGAGG - Intronic
958938055 3:100279253-100279275 TCCTCATAACAATCCCTATGAGG - Intronic
963668420 3:148220342-148220364 TGTTCAAGAAAACCCCAAAGGGG - Intergenic
963773675 3:149416387-149416409 TCCTCAAAACAACCCAAAGAGGG + Intergenic
965517580 3:169638293-169638315 TCCCCAAGACCTCCCCAATGTGG + Intronic
966596767 3:181731054-181731076 AACTCAAGTCACCCCCAATGGGG + Intergenic
966995169 3:185272639-185272661 TCCTAAAGAAAACCCAATTGTGG + Intronic
969399708 4:6946113-6946135 TCTTCAAGACAAGCCCCGTGAGG + Intronic
971166976 4:24193826-24193848 TGCTCAAGAGTACACCAATGGGG + Intergenic
971474480 4:27059180-27059202 TCCTCATGACAACCACTGTGGGG - Intergenic
971555841 4:28012556-28012578 CCCCCAAGTCAGCCCCAATGGGG - Intergenic
973338308 4:48978649-48978671 TGGCCAAGACAACCTCAATGGGG - Intergenic
977931857 4:102758438-102758460 TCCTCAAGTCAACACCAAAAAGG + Intronic
979808543 4:125005584-125005606 TCCTCAACTCAACCCAACTGTGG - Intergenic
989753073 5:44919167-44919189 TCCTCCTGACAAGCCAAATGGGG + Intergenic
990355831 5:54965237-54965259 TCCTCACAACAACCCCATTGAGG - Intergenic
991064489 5:62411228-62411250 TCCTCAGAACAACCCTTATGAGG - Intronic
993034410 5:82741243-82741265 TCCCCCAGACTTCCCCAATGGGG - Intergenic
994077315 5:95667858-95667880 TCCTGAAGACAGCACCAAGGGGG - Intronic
995649733 5:114357079-114357101 TCCTTCAGACCACCCCAATATGG + Intergenic
996342128 5:122450907-122450929 ACCCCAAGACTACCCCAGTGAGG + Exonic
998839567 5:146238914-146238936 TACTCAAAACAACCTTAATGAGG - Intronic
999222403 5:149991391-149991413 TCCTCATGACAACACAATTGAGG + Intronic
1000086404 5:157891242-157891264 TCCTCAAGACAACCCTGTTTAGG - Intergenic
1002126551 5:177049781-177049803 TCCTCAGAACTACCCCAATGAGG - Intronic
1003559868 6:7171612-7171634 TCCTCAAAACAACAACCATGAGG - Intronic
1003950131 6:11109045-11109067 TCCCCAGGTCAACCCCAATTGGG - Intronic
1006289214 6:33121605-33121627 TCCTCTCGACAACCCCAACTGGG - Intergenic
1011216232 6:85008791-85008813 TCCCCATGACAACACCAAGGGGG - Intergenic
1013597317 6:111672022-111672044 AGCTCACGACACCCCCAATGAGG + Intronic
1015003986 6:128256116-128256138 TCCTCAAGAGAGTCACAATGTGG + Intronic
1015453567 6:133398767-133398789 TCCTAAAGAAAACCCTAATATGG + Intronic
1015875265 6:137816207-137816229 CCCTCATGCCAACCACAATGAGG + Intergenic
1017409882 6:154156867-154156889 TCCTCTTCACAACCCCAAAGAGG + Intronic
1019094112 6:169564887-169564909 TCCTCATGCCAACACCCATGTGG + Intronic
1020695168 7:11405056-11405078 TCCTCAAAATAACCCCTATCAGG + Intronic
1020798669 7:12706453-12706475 TCCTCATGACAACTCTAAAGGGG - Intergenic
1022866182 7:34423550-34423572 TCTTCAAGACAACTTCAGTGGGG + Intergenic
1023245519 7:38199241-38199263 TCCTTAAGCCAACCCCAGAGAGG + Intronic
1027799555 7:82734448-82734470 TCCTCTAGACACTCCCAGTGTGG - Intergenic
1029102960 7:98149149-98149171 TCCTCAGGACAACCCCAGTTAGG + Intronic
1029309745 7:99651805-99651827 TGCTCAAGACACCTCCAAGGAGG + Intronic
1030057029 7:105592087-105592109 TCCTGAAGACAACCCCTGTGAGG - Intronic
1032724675 7:134579941-134579963 TCCTCAAAATAACCCCTTTGGGG + Intergenic
1033041630 7:137924488-137924510 TCATAAAGACAACCTCCATGTGG + Intronic
1036559268 8:9887797-9887819 ACATGAAGAAAACCCCAATGGGG - Intergenic
1037260581 8:17002586-17002608 TCCCAAGGACAACCCCAAAGAGG - Intergenic
1038923865 8:32116112-32116134 TTTTCCAGACAACTCCAATGGGG + Intronic
1040380185 8:46864928-46864950 TCCTCAAGACAAGCCCAAGGAGG + Intergenic
1040903388 8:52439902-52439924 TCCTAAAGACAAGCCCAAAACGG - Intronic
1041157720 8:55005338-55005360 TCCACAAAACAAGCCCAGTGCGG + Intergenic
1043522771 8:81064099-81064121 TCCCCAAGTCAACCCCGGTGTGG - Intronic
1044787340 8:95808606-95808628 TCCACAAGCCAACCCTAGTGTGG - Intergenic
1044897267 8:96905599-96905621 TCCTCAATTCAACCCTATTGGGG - Intronic
1045942248 8:107752847-107752869 TCCTCAAAACCAACCCTATGAGG + Intergenic
1046236734 8:111434042-111434064 TCCTCAAGAAAACACTCATGGGG - Intergenic
1048051444 8:130820856-130820878 TCCTCAAGACAGCCCTATTTAGG + Intronic
1049826808 8:144674332-144674354 TCGTCAAGACAACCCGTATGCGG - Intergenic
1050430586 9:5557872-5557894 TCATCAAGACAAGCTCAAAGTGG - Intronic
1051594572 9:18811362-18811384 TCCTCTACACCACCCCAGTGGGG - Intronic
1056164009 9:83924506-83924528 TCCTCAAGACAATCTTCATGGGG - Intergenic
1059652872 9:116332250-116332272 TCCTCAAATGCACCCCAATGTGG + Intronic
1060787336 9:126460877-126460899 TCCTCAAGGCAACCCCATGAGGG - Intronic
1061537095 9:131256981-131257003 TCCTCATGACAACCCCACAAGGG - Intergenic
1061663701 9:132148003-132148025 TCCTCAAAACAATCCCATGGGGG + Intergenic
1062089332 9:134666677-134666699 TCCTCCAGGCACCCCCAGTGAGG - Intronic
1186943431 X:14538278-14538300 TCCTCAGTACAACCCAAGTGAGG - Intronic
1190845966 X:54190899-54190921 ACCTCAAAACAACCTCACTGAGG + Intergenic
1192158282 X:68763090-68763112 TCCACAAGACAACCCCTGAGTGG + Intergenic
1193575161 X:83186561-83186583 TGCTCAACCCAACCCCACTGTGG + Intergenic
1194816495 X:98447906-98447928 TCCTTAATACCACCACAATGGGG + Intergenic
1195029157 X:100909578-100909600 TCCTCACAACAACCCTTATGAGG - Intergenic
1199900666 X:152168961-152168983 TCCTCAGAGCAACCCCTATGAGG + Intronic
1202266800 Y:23028206-23028228 TCCTCAAGGCAAGCCCAGGGAGG - Intergenic
1202419793 Y:24661951-24661973 TCCTCAAGGCAAGCCCAGGGAGG - Intergenic
1202450993 Y:25008133-25008155 TCCTCAAGGCAAGCCCAGGGAGG + Intergenic