ID: 950453378

View in Genome Browser
Species Human (GRCh38)
Location 3:13078336-13078358
Sequence GCTCCATCCTGTCCTGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950453378_950453380 6 Left 950453378 3:13078336-13078358 CCAATGGCAGGACAGGATGGAGC No data
Right 950453380 3:13078365-13078387 AGACACTAAATCAGAGATGCTGG No data
950453378_950453381 7 Left 950453378 3:13078336-13078358 CCAATGGCAGGACAGGATGGAGC No data
Right 950453381 3:13078366-13078388 GACACTAAATCAGAGATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950453378 Original CRISPR GCTCCATCCTGTCCTGCCAT TGG (reversed) Intergenic
No off target data available for this crispr