ID: 950453378 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:13078336-13078358 |
Sequence | GCTCCATCCTGTCCTGCCAT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
950453378_950453380 | 6 | Left | 950453378 | 3:13078336-13078358 | CCAATGGCAGGACAGGATGGAGC | No data | ||
Right | 950453380 | 3:13078365-13078387 | AGACACTAAATCAGAGATGCTGG | No data | ||||
950453378_950453381 | 7 | Left | 950453378 | 3:13078336-13078358 | CCAATGGCAGGACAGGATGGAGC | No data | ||
Right | 950453381 | 3:13078366-13078388 | GACACTAAATCAGAGATGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
950453378 | Original CRISPR | GCTCCATCCTGTCCTGCCAT TGG (reversed) | Intergenic | ||