ID: 950453380

View in Genome Browser
Species Human (GRCh38)
Location 3:13078365-13078387
Sequence AGACACTAAATCAGAGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950453378_950453380 6 Left 950453378 3:13078336-13078358 CCAATGGCAGGACAGGATGGAGC No data
Right 950453380 3:13078365-13078387 AGACACTAAATCAGAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950453380 Original CRISPR AGACACTAAATCAGAGATGC TGG Intergenic
No off target data available for this crispr