ID: 950453381

View in Genome Browser
Species Human (GRCh38)
Location 3:13078366-13078388
Sequence GACACTAAATCAGAGATGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950453378_950453381 7 Left 950453378 3:13078336-13078358 CCAATGGCAGGACAGGATGGAGC No data
Right 950453381 3:13078366-13078388 GACACTAAATCAGAGATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950453381 Original CRISPR GACACTAAATCAGAGATGCT GGG Intergenic