ID: 950453680

View in Genome Browser
Species Human (GRCh38)
Location 3:13079949-13079971
Sequence GTTTCAACATCTTGTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950453680_950453681 -10 Left 950453680 3:13079949-13079971 CCTGGAGGACAAGATGTTGAAAC No data
Right 950453681 3:13079962-13079984 ATGTTGAAACAGAGTCTTGAAGG No data
950453680_950453682 -9 Left 950453680 3:13079949-13079971 CCTGGAGGACAAGATGTTGAAAC No data
Right 950453682 3:13079963-13079985 TGTTGAAACAGAGTCTTGAAGGG No data
950453680_950453686 24 Left 950453680 3:13079949-13079971 CCTGGAGGACAAGATGTTGAAAC No data
Right 950453686 3:13079996-13080018 CTTGTTAGGCAGACAGTGCATGG No data
950453680_950453684 10 Left 950453680 3:13079949-13079971 CCTGGAGGACAAGATGTTGAAAC No data
Right 950453684 3:13079982-13080004 AGGGTGGCCAGAAGCTTGTTAGG No data
950453680_950453687 29 Left 950453680 3:13079949-13079971 CCTGGAGGACAAGATGTTGAAAC No data
Right 950453687 3:13080001-13080023 TAGGCAGACAGTGCATGGAAAGG No data
950453680_950453683 -6 Left 950453680 3:13079949-13079971 CCTGGAGGACAAGATGTTGAAAC No data
Right 950453683 3:13079966-13079988 TGAAACAGAGTCTTGAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950453680 Original CRISPR GTTTCAACATCTTGTCCTCC AGG (reversed) Intergenic
No off target data available for this crispr