ID: 950453686

View in Genome Browser
Species Human (GRCh38)
Location 3:13079996-13080018
Sequence CTTGTTAGGCAGACAGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950453680_950453686 24 Left 950453680 3:13079949-13079971 CCTGGAGGACAAGATGTTGAAAC No data
Right 950453686 3:13079996-13080018 CTTGTTAGGCAGACAGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950453686 Original CRISPR CTTGTTAGGCAGACAGTGCA TGG Intergenic
No off target data available for this crispr