ID: 950454306

View in Genome Browser
Species Human (GRCh38)
Location 3:13083606-13083628
Sequence CAGGCTTCTGACTGCAACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950454306_950454315 26 Left 950454306 3:13083606-13083628 CCTGCGTTGCAGTCAGAAGCCTG No data
Right 950454315 3:13083655-13083677 GCCTTGCTAGATGCTTCATCTGG No data
950454306_950454309 -8 Left 950454306 3:13083606-13083628 CCTGCGTTGCAGTCAGAAGCCTG No data
Right 950454309 3:13083621-13083643 GAAGCCTGGCCTGTGGCCGCAGG No data
950454306_950454313 1 Left 950454306 3:13083606-13083628 CCTGCGTTGCAGTCAGAAGCCTG No data
Right 950454313 3:13083630-13083652 CCTGTGGCCGCAGGGTCTCTAGG No data
950454306_950454310 -7 Left 950454306 3:13083606-13083628 CCTGCGTTGCAGTCAGAAGCCTG No data
Right 950454310 3:13083622-13083644 AAGCCTGGCCTGTGGCCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950454306 Original CRISPR CAGGCTTCTGACTGCAACGC AGG (reversed) Intergenic
No off target data available for this crispr