ID: 950458145

View in Genome Browser
Species Human (GRCh38)
Location 3:13104777-13104799
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950458141_950458145 -8 Left 950458141 3:13104762-13104784 CCAACTAGGTCCTGCCTGGCCCC No data
Right 950458145 3:13104777-13104799 CTGGCCCCTGACCCATGTGAGGG No data
950458135_950458145 21 Left 950458135 3:13104733-13104755 CCGGCCACTAGCGGACGCTAACC No data
Right 950458145 3:13104777-13104799 CTGGCCCCTGACCCATGTGAGGG No data
950458131_950458145 30 Left 950458131 3:13104724-13104746 CCCCTCACTCCGGCCACTAGCGG No data
Right 950458145 3:13104777-13104799 CTGGCCCCTGACCCATGTGAGGG No data
950458138_950458145 0 Left 950458138 3:13104754-13104776 CCCAACAACCAACTAGGTCCTGC No data
Right 950458145 3:13104777-13104799 CTGGCCCCTGACCCATGTGAGGG No data
950458136_950458145 17 Left 950458136 3:13104737-13104759 CCACTAGCGGACGCTAACCCAAC No data
Right 950458145 3:13104777-13104799 CTGGCCCCTGACCCATGTGAGGG No data
950458133_950458145 29 Left 950458133 3:13104725-13104747 CCCTCACTCCGGCCACTAGCGGA No data
Right 950458145 3:13104777-13104799 CTGGCCCCTGACCCATGTGAGGG No data
950458139_950458145 -1 Left 950458139 3:13104755-13104777 CCAACAACCAACTAGGTCCTGCC No data
Right 950458145 3:13104777-13104799 CTGGCCCCTGACCCATGTGAGGG No data
950458134_950458145 28 Left 950458134 3:13104726-13104748 CCTCACTCCGGCCACTAGCGGAC No data
Right 950458145 3:13104777-13104799 CTGGCCCCTGACCCATGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type