ID: 950459179

View in Genome Browser
Species Human (GRCh38)
Location 3:13111090-13111112
Sequence TGCAGGGCAGGAGCTGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950459179_950459186 10 Left 950459179 3:13111090-13111112 CCCAGCACAGCTCCTGCCCTGCA No data
Right 950459186 3:13111123-13111145 AGCAAAACACTGCATTTCCCAGG No data
950459179_950459189 30 Left 950459179 3:13111090-13111112 CCCAGCACAGCTCCTGCCCTGCA No data
Right 950459189 3:13111143-13111165 AGGTACCATACAGCTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950459179 Original CRISPR TGCAGGGCAGGAGCTGTGCT GGG (reversed) Intergenic
No off target data available for this crispr