ID: 950459180

View in Genome Browser
Species Human (GRCh38)
Location 3:13111091-13111113
Sequence CTGCAGGGCAGGAGCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950459180_950459189 29 Left 950459180 3:13111091-13111113 CCAGCACAGCTCCTGCCCTGCAG No data
Right 950459189 3:13111143-13111165 AGGTACCATACAGCTGAGTCTGG No data
950459180_950459186 9 Left 950459180 3:13111091-13111113 CCAGCACAGCTCCTGCCCTGCAG No data
Right 950459186 3:13111123-13111145 AGCAAAACACTGCATTTCCCAGG No data
950459180_950459190 30 Left 950459180 3:13111091-13111113 CCAGCACAGCTCCTGCCCTGCAG No data
Right 950459190 3:13111144-13111166 GGTACCATACAGCTGAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950459180 Original CRISPR CTGCAGGGCAGGAGCTGTGC TGG (reversed) Intergenic
No off target data available for this crispr