ID: 950459183

View in Genome Browser
Species Human (GRCh38)
Location 3:13111102-13111124
Sequence CTCTCCAGCCTCTGCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950459183_950459186 -2 Left 950459183 3:13111102-13111124 CCTGCCCTGCAGAGGCTGGAGAG No data
Right 950459186 3:13111123-13111145 AGCAAAACACTGCATTTCCCAGG No data
950459183_950459190 19 Left 950459183 3:13111102-13111124 CCTGCCCTGCAGAGGCTGGAGAG No data
Right 950459190 3:13111144-13111166 GGTACCATACAGCTGAGTCTGGG No data
950459183_950459189 18 Left 950459183 3:13111102-13111124 CCTGCCCTGCAGAGGCTGGAGAG No data
Right 950459189 3:13111143-13111165 AGGTACCATACAGCTGAGTCTGG No data
950459183_950459191 22 Left 950459183 3:13111102-13111124 CCTGCCCTGCAGAGGCTGGAGAG No data
Right 950459191 3:13111147-13111169 ACCATACAGCTGAGTCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950459183 Original CRISPR CTCTCCAGCCTCTGCAGGGC AGG (reversed) Intergenic