ID: 950459184

View in Genome Browser
Species Human (GRCh38)
Location 3:13111106-13111128
Sequence TTTGCTCTCCAGCCTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950459184_950459189 14 Left 950459184 3:13111106-13111128 CCCTGCAGAGGCTGGAGAGCAAA No data
Right 950459189 3:13111143-13111165 AGGTACCATACAGCTGAGTCTGG No data
950459184_950459186 -6 Left 950459184 3:13111106-13111128 CCCTGCAGAGGCTGGAGAGCAAA No data
Right 950459186 3:13111123-13111145 AGCAAAACACTGCATTTCCCAGG No data
950459184_950459190 15 Left 950459184 3:13111106-13111128 CCCTGCAGAGGCTGGAGAGCAAA No data
Right 950459190 3:13111144-13111166 GGTACCATACAGCTGAGTCTGGG No data
950459184_950459191 18 Left 950459184 3:13111106-13111128 CCCTGCAGAGGCTGGAGAGCAAA No data
Right 950459191 3:13111147-13111169 ACCATACAGCTGAGTCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950459184 Original CRISPR TTTGCTCTCCAGCCTCTGCA GGG (reversed) Intergenic
No off target data available for this crispr