ID: 950459185

View in Genome Browser
Species Human (GRCh38)
Location 3:13111107-13111129
Sequence TTTTGCTCTCCAGCCTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950459185_950459190 14 Left 950459185 3:13111107-13111129 CCTGCAGAGGCTGGAGAGCAAAA No data
Right 950459190 3:13111144-13111166 GGTACCATACAGCTGAGTCTGGG No data
950459185_950459191 17 Left 950459185 3:13111107-13111129 CCTGCAGAGGCTGGAGAGCAAAA No data
Right 950459191 3:13111147-13111169 ACCATACAGCTGAGTCTGGGAGG No data
950459185_950459189 13 Left 950459185 3:13111107-13111129 CCTGCAGAGGCTGGAGAGCAAAA No data
Right 950459189 3:13111143-13111165 AGGTACCATACAGCTGAGTCTGG No data
950459185_950459186 -7 Left 950459185 3:13111107-13111129 CCTGCAGAGGCTGGAGAGCAAAA No data
Right 950459186 3:13111123-13111145 AGCAAAACACTGCATTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950459185 Original CRISPR TTTTGCTCTCCAGCCTCTGC AGG (reversed) Intergenic
No off target data available for this crispr