ID: 950459186

View in Genome Browser
Species Human (GRCh38)
Location 3:13111123-13111145
Sequence AGCAAAACACTGCATTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950459185_950459186 -7 Left 950459185 3:13111107-13111129 CCTGCAGAGGCTGGAGAGCAAAA No data
Right 950459186 3:13111123-13111145 AGCAAAACACTGCATTTCCCAGG No data
950459177_950459186 17 Left 950459177 3:13111083-13111105 CCACTGCCCCAGCACAGCTCCTG No data
Right 950459186 3:13111123-13111145 AGCAAAACACTGCATTTCCCAGG No data
950459176_950459186 18 Left 950459176 3:13111082-13111104 CCCACTGCCCCAGCACAGCTCCT No data
Right 950459186 3:13111123-13111145 AGCAAAACACTGCATTTCCCAGG No data
950459180_950459186 9 Left 950459180 3:13111091-13111113 CCAGCACAGCTCCTGCCCTGCAG No data
Right 950459186 3:13111123-13111145 AGCAAAACACTGCATTTCCCAGG No data
950459178_950459186 11 Left 950459178 3:13111089-13111111 CCCCAGCACAGCTCCTGCCCTGC No data
Right 950459186 3:13111123-13111145 AGCAAAACACTGCATTTCCCAGG No data
950459183_950459186 -2 Left 950459183 3:13111102-13111124 CCTGCCCTGCAGAGGCTGGAGAG No data
Right 950459186 3:13111123-13111145 AGCAAAACACTGCATTTCCCAGG No data
950459184_950459186 -6 Left 950459184 3:13111106-13111128 CCCTGCAGAGGCTGGAGAGCAAA No data
Right 950459186 3:13111123-13111145 AGCAAAACACTGCATTTCCCAGG No data
950459179_950459186 10 Left 950459179 3:13111090-13111112 CCCAGCACAGCTCCTGCCCTGCA No data
Right 950459186 3:13111123-13111145 AGCAAAACACTGCATTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950459186 Original CRISPR AGCAAAACACTGCATTTCCC AGG Intergenic
No off target data available for this crispr