ID: 950459189

View in Genome Browser
Species Human (GRCh38)
Location 3:13111143-13111165
Sequence AGGTACCATACAGCTGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950459180_950459189 29 Left 950459180 3:13111091-13111113 CCAGCACAGCTCCTGCCCTGCAG No data
Right 950459189 3:13111143-13111165 AGGTACCATACAGCTGAGTCTGG No data
950459183_950459189 18 Left 950459183 3:13111102-13111124 CCTGCCCTGCAGAGGCTGGAGAG No data
Right 950459189 3:13111143-13111165 AGGTACCATACAGCTGAGTCTGG No data
950459179_950459189 30 Left 950459179 3:13111090-13111112 CCCAGCACAGCTCCTGCCCTGCA No data
Right 950459189 3:13111143-13111165 AGGTACCATACAGCTGAGTCTGG No data
950459184_950459189 14 Left 950459184 3:13111106-13111128 CCCTGCAGAGGCTGGAGAGCAAA No data
Right 950459189 3:13111143-13111165 AGGTACCATACAGCTGAGTCTGG No data
950459185_950459189 13 Left 950459185 3:13111107-13111129 CCTGCAGAGGCTGGAGAGCAAAA No data
Right 950459189 3:13111143-13111165 AGGTACCATACAGCTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950459189 Original CRISPR AGGTACCATACAGCTGAGTC TGG Intergenic
No off target data available for this crispr