ID: 950459191

View in Genome Browser
Species Human (GRCh38)
Location 3:13111147-13111169
Sequence ACCATACAGCTGAGTCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950459185_950459191 17 Left 950459185 3:13111107-13111129 CCTGCAGAGGCTGGAGAGCAAAA No data
Right 950459191 3:13111147-13111169 ACCATACAGCTGAGTCTGGGAGG No data
950459183_950459191 22 Left 950459183 3:13111102-13111124 CCTGCCCTGCAGAGGCTGGAGAG No data
Right 950459191 3:13111147-13111169 ACCATACAGCTGAGTCTGGGAGG No data
950459184_950459191 18 Left 950459184 3:13111106-13111128 CCCTGCAGAGGCTGGAGAGCAAA No data
Right 950459191 3:13111147-13111169 ACCATACAGCTGAGTCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950459191 Original CRISPR ACCATACAGCTGAGTCTGGG AGG Intergenic
No off target data available for this crispr