ID: 950459477

View in Genome Browser
Species Human (GRCh38)
Location 3:13112655-13112677
Sequence GTGGTCCCGCAGCAGAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950459472_950459477 -1 Left 950459472 3:13112633-13112655 CCTCGCACAGACAGTGGGCCAGG No data
Right 950459477 3:13112655-13112677 GTGGTCCCGCAGCAGAGTGTGGG No data
950459469_950459477 20 Left 950459469 3:13112612-13112634 CCATGGTGGATGCGGCAGGAGCC No data
Right 950459477 3:13112655-13112677 GTGGTCCCGCAGCAGAGTGTGGG No data
950459467_950459477 24 Left 950459467 3:13112608-13112630 CCTGCCATGGTGGATGCGGCAGG No data
Right 950459477 3:13112655-13112677 GTGGTCCCGCAGCAGAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950459477 Original CRISPR GTGGTCCCGCAGCAGAGTGT GGG Intergenic
No off target data available for this crispr