ID: 950462576

View in Genome Browser
Species Human (GRCh38)
Location 3:13134226-13134248
Sequence CCAGATATGCAGGGGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950462559_950462576 15 Left 950462559 3:13134188-13134210 CCTGGCCAGTTGCCCCTCGTCAG No data
Right 950462576 3:13134226-13134248 CCAGATATGCAGGGGCTGCAGGG No data
950462562_950462576 10 Left 950462562 3:13134193-13134215 CCAGTTGCCCCTCGTCAGGGCTG No data
Right 950462576 3:13134226-13134248 CCAGATATGCAGGGGCTGCAGGG No data
950462564_950462576 3 Left 950462564 3:13134200-13134222 CCCCTCGTCAGGGCTGGAGCTGG No data
Right 950462576 3:13134226-13134248 CCAGATATGCAGGGGCTGCAGGG No data
950462568_950462576 1 Left 950462568 3:13134202-13134224 CCTCGTCAGGGCTGGAGCTGGGG No data
Right 950462576 3:13134226-13134248 CCAGATATGCAGGGGCTGCAGGG No data
950462566_950462576 2 Left 950462566 3:13134201-13134223 CCCTCGTCAGGGCTGGAGCTGGG No data
Right 950462576 3:13134226-13134248 CCAGATATGCAGGGGCTGCAGGG No data
950462558_950462576 25 Left 950462558 3:13134178-13134200 CCTCTAGGGTCCTGGCCAGTTGC No data
Right 950462576 3:13134226-13134248 CCAGATATGCAGGGGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950462576 Original CRISPR CCAGATATGCAGGGGCTGCA GGG Intergenic
No off target data available for this crispr