ID: 950463958

View in Genome Browser
Species Human (GRCh38)
Location 3:13142338-13142360
Sequence CTGTGTCTGAGCATGCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950463958_950463964 4 Left 950463958 3:13142338-13142360 CCCAGATGCATGCTCAGACACAG No data
Right 950463964 3:13142365-13142387 TTTCCTTTGGAAGCCACCCCAGG No data
950463958_950463960 -9 Left 950463958 3:13142338-13142360 CCCAGATGCATGCTCAGACACAG No data
Right 950463960 3:13142352-13142374 CAGACACAGCCCCTTTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950463958 Original CRISPR CTGTGTCTGAGCATGCATCT GGG (reversed) Intergenic
No off target data available for this crispr