ID: 950464314

View in Genome Browser
Species Human (GRCh38)
Location 3:13144319-13144341
Sequence AGATATCAGGCATCCACGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950464314_950464322 11 Left 950464314 3:13144319-13144341 CCAGCCGTGGATGCCTGATATCT No data
Right 950464322 3:13144353-13144375 CGTGGCTGTCAGGAGACTCATGG No data
950464314_950464323 30 Left 950464314 3:13144319-13144341 CCAGCCGTGGATGCCTGATATCT No data
Right 950464323 3:13144372-13144394 ATGGCAGCCACCCACATCAGAGG No data
950464314_950464318 -7 Left 950464314 3:13144319-13144341 CCAGCCGTGGATGCCTGATATCT No data
Right 950464318 3:13144335-13144357 GATATCTGGTCACCGCCACGTGG No data
950464314_950464319 1 Left 950464314 3:13144319-13144341 CCAGCCGTGGATGCCTGATATCT No data
Right 950464319 3:13144343-13144365 GTCACCGCCACGTGGCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950464314 Original CRISPR AGATATCAGGCATCCACGGC TGG (reversed) Intergenic