ID: 950464316

View in Genome Browser
Species Human (GRCh38)
Location 3:13144323-13144345
Sequence GACCAGATATCAGGCATCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950464316_950464324 27 Left 950464316 3:13144323-13144345 CCGTGGATGCCTGATATCTGGTC No data
Right 950464324 3:13144373-13144395 TGGCAGCCACCCACATCAGAGGG No data
950464316_950464319 -3 Left 950464316 3:13144323-13144345 CCGTGGATGCCTGATATCTGGTC No data
Right 950464319 3:13144343-13144365 GTCACCGCCACGTGGCTGTCAGG No data
950464316_950464322 7 Left 950464316 3:13144323-13144345 CCGTGGATGCCTGATATCTGGTC No data
Right 950464322 3:13144353-13144375 CGTGGCTGTCAGGAGACTCATGG No data
950464316_950464323 26 Left 950464316 3:13144323-13144345 CCGTGGATGCCTGATATCTGGTC No data
Right 950464323 3:13144372-13144394 ATGGCAGCCACCCACATCAGAGG No data
950464316_950464325 30 Left 950464316 3:13144323-13144345 CCGTGGATGCCTGATATCTGGTC No data
Right 950464325 3:13144376-13144398 CAGCCACCCACATCAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950464316 Original CRISPR GACCAGATATCAGGCATCCA CGG (reversed) Intergenic