ID: 950464317

View in Genome Browser
Species Human (GRCh38)
Location 3:13144332-13144354
Sequence CGTGGCGGTGACCAGATATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950464317_950464322 -2 Left 950464317 3:13144332-13144354 CCTGATATCTGGTCACCGCCACG No data
Right 950464322 3:13144353-13144375 CGTGGCTGTCAGGAGACTCATGG No data
950464317_950464328 26 Left 950464317 3:13144332-13144354 CCTGATATCTGGTCACCGCCACG No data
Right 950464328 3:13144381-13144403 ACCCACATCAGAGGGAGGCAGGG No data
950464317_950464325 21 Left 950464317 3:13144332-13144354 CCTGATATCTGGTCACCGCCACG No data
Right 950464325 3:13144376-13144398 CAGCCACCCACATCAGAGGGAGG No data
950464317_950464327 25 Left 950464317 3:13144332-13144354 CCTGATATCTGGTCACCGCCACG No data
Right 950464327 3:13144380-13144402 CACCCACATCAGAGGGAGGCAGG No data
950464317_950464324 18 Left 950464317 3:13144332-13144354 CCTGATATCTGGTCACCGCCACG No data
Right 950464324 3:13144373-13144395 TGGCAGCCACCCACATCAGAGGG No data
950464317_950464323 17 Left 950464317 3:13144332-13144354 CCTGATATCTGGTCACCGCCACG No data
Right 950464323 3:13144372-13144394 ATGGCAGCCACCCACATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950464317 Original CRISPR CGTGGCGGTGACCAGATATC AGG (reversed) Intergenic