ID: 950464320

View in Genome Browser
Species Human (GRCh38)
Location 3:13144347-13144369
Sequence GTCTCCTGACAGCCACGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950464320_950464323 2 Left 950464320 3:13144347-13144369 CCGCCACGTGGCTGTCAGGAGAC No data
Right 950464323 3:13144372-13144394 ATGGCAGCCACCCACATCAGAGG No data
950464320_950464327 10 Left 950464320 3:13144347-13144369 CCGCCACGTGGCTGTCAGGAGAC No data
Right 950464327 3:13144380-13144402 CACCCACATCAGAGGGAGGCAGG No data
950464320_950464328 11 Left 950464320 3:13144347-13144369 CCGCCACGTGGCTGTCAGGAGAC No data
Right 950464328 3:13144381-13144403 ACCCACATCAGAGGGAGGCAGGG No data
950464320_950464331 20 Left 950464320 3:13144347-13144369 CCGCCACGTGGCTGTCAGGAGAC No data
Right 950464331 3:13144390-13144412 AGAGGGAGGCAGGGAGAGTGCGG No data
950464320_950464324 3 Left 950464320 3:13144347-13144369 CCGCCACGTGGCTGTCAGGAGAC No data
Right 950464324 3:13144373-13144395 TGGCAGCCACCCACATCAGAGGG No data
950464320_950464325 6 Left 950464320 3:13144347-13144369 CCGCCACGTGGCTGTCAGGAGAC No data
Right 950464325 3:13144376-13144398 CAGCCACCCACATCAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950464320 Original CRISPR GTCTCCTGACAGCCACGTGG CGG (reversed) Intergenic