ID: 950464321

View in Genome Browser
Species Human (GRCh38)
Location 3:13144350-13144372
Sequence TGAGTCTCCTGACAGCCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950464321_950464324 0 Left 950464321 3:13144350-13144372 CCACGTGGCTGTCAGGAGACTCA No data
Right 950464324 3:13144373-13144395 TGGCAGCCACCCACATCAGAGGG No data
950464321_950464331 17 Left 950464321 3:13144350-13144372 CCACGTGGCTGTCAGGAGACTCA No data
Right 950464331 3:13144390-13144412 AGAGGGAGGCAGGGAGAGTGCGG No data
950464321_950464323 -1 Left 950464321 3:13144350-13144372 CCACGTGGCTGTCAGGAGACTCA No data
Right 950464323 3:13144372-13144394 ATGGCAGCCACCCACATCAGAGG No data
950464321_950464327 7 Left 950464321 3:13144350-13144372 CCACGTGGCTGTCAGGAGACTCA No data
Right 950464327 3:13144380-13144402 CACCCACATCAGAGGGAGGCAGG No data
950464321_950464325 3 Left 950464321 3:13144350-13144372 CCACGTGGCTGTCAGGAGACTCA No data
Right 950464325 3:13144376-13144398 CAGCCACCCACATCAGAGGGAGG No data
950464321_950464328 8 Left 950464321 3:13144350-13144372 CCACGTGGCTGTCAGGAGACTCA No data
Right 950464328 3:13144381-13144403 ACCCACATCAGAGGGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950464321 Original CRISPR TGAGTCTCCTGACAGCCACG TGG (reversed) Intergenic