ID: 950464325

View in Genome Browser
Species Human (GRCh38)
Location 3:13144376-13144398
Sequence CAGCCACCCACATCAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950464316_950464325 30 Left 950464316 3:13144323-13144345 CCGTGGATGCCTGATATCTGGTC No data
Right 950464325 3:13144376-13144398 CAGCCACCCACATCAGAGGGAGG No data
950464321_950464325 3 Left 950464321 3:13144350-13144372 CCACGTGGCTGTCAGGAGACTCA No data
Right 950464325 3:13144376-13144398 CAGCCACCCACATCAGAGGGAGG No data
950464317_950464325 21 Left 950464317 3:13144332-13144354 CCTGATATCTGGTCACCGCCACG No data
Right 950464325 3:13144376-13144398 CAGCCACCCACATCAGAGGGAGG No data
950464320_950464325 6 Left 950464320 3:13144347-13144369 CCGCCACGTGGCTGTCAGGAGAC No data
Right 950464325 3:13144376-13144398 CAGCCACCCACATCAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950464325 Original CRISPR CAGCCACCCACATCAGAGGG AGG Intergenic