ID: 950464328

View in Genome Browser
Species Human (GRCh38)
Location 3:13144381-13144403
Sequence ACCCACATCAGAGGGAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950464321_950464328 8 Left 950464321 3:13144350-13144372 CCACGTGGCTGTCAGGAGACTCA No data
Right 950464328 3:13144381-13144403 ACCCACATCAGAGGGAGGCAGGG No data
950464320_950464328 11 Left 950464320 3:13144347-13144369 CCGCCACGTGGCTGTCAGGAGAC No data
Right 950464328 3:13144381-13144403 ACCCACATCAGAGGGAGGCAGGG No data
950464317_950464328 26 Left 950464317 3:13144332-13144354 CCTGATATCTGGTCACCGCCACG No data
Right 950464328 3:13144381-13144403 ACCCACATCAGAGGGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950464328 Original CRISPR ACCCACATCAGAGGGAGGCA GGG Intergenic