ID: 950464331

View in Genome Browser
Species Human (GRCh38)
Location 3:13144390-13144412
Sequence AGAGGGAGGCAGGGAGAGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950464320_950464331 20 Left 950464320 3:13144347-13144369 CCGCCACGTGGCTGTCAGGAGAC No data
Right 950464331 3:13144390-13144412 AGAGGGAGGCAGGGAGAGTGCGG No data
950464321_950464331 17 Left 950464321 3:13144350-13144372 CCACGTGGCTGTCAGGAGACTCA No data
Right 950464331 3:13144390-13144412 AGAGGGAGGCAGGGAGAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950464331 Original CRISPR AGAGGGAGGCAGGGAGAGTG CGG Intergenic