ID: 950465473

View in Genome Browser
Species Human (GRCh38)
Location 3:13150859-13150881
Sequence TCTATTTACCACTCTCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950465473_950465479 22 Left 950465473 3:13150859-13150881 CCCACCTGAGAGTGGTAAATAGA No data
Right 950465479 3:13150904-13150926 GTGTGAAAGCAGATGGTCCAGGG No data
950465473_950465480 26 Left 950465473 3:13150859-13150881 CCCACCTGAGAGTGGTAAATAGA No data
Right 950465480 3:13150908-13150930 GAAAGCAGATGGTCCAGGGCTGG No data
950465473_950465478 21 Left 950465473 3:13150859-13150881 CCCACCTGAGAGTGGTAAATAGA No data
Right 950465478 3:13150903-13150925 AGTGTGAAAGCAGATGGTCCAGG No data
950465473_950465477 15 Left 950465473 3:13150859-13150881 CCCACCTGAGAGTGGTAAATAGA No data
Right 950465477 3:13150897-13150919 CATTTCAGTGTGAAAGCAGATGG No data
950465473_950465476 -8 Left 950465473 3:13150859-13150881 CCCACCTGAGAGTGGTAAATAGA No data
Right 950465476 3:13150874-13150896 TAAATAGAAATTTGTGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950465473 Original CRISPR TCTATTTACCACTCTCAGGT GGG (reversed) Intergenic
No off target data available for this crispr