ID: 950465474

View in Genome Browser
Species Human (GRCh38)
Location 3:13150860-13150882
Sequence TTCTATTTACCACTCTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950465474_950465476 -9 Left 950465474 3:13150860-13150882 CCACCTGAGAGTGGTAAATAGAA No data
Right 950465476 3:13150874-13150896 TAAATAGAAATTTGTGTCTCTGG No data
950465474_950465477 14 Left 950465474 3:13150860-13150882 CCACCTGAGAGTGGTAAATAGAA No data
Right 950465477 3:13150897-13150919 CATTTCAGTGTGAAAGCAGATGG No data
950465474_950465479 21 Left 950465474 3:13150860-13150882 CCACCTGAGAGTGGTAAATAGAA No data
Right 950465479 3:13150904-13150926 GTGTGAAAGCAGATGGTCCAGGG No data
950465474_950465478 20 Left 950465474 3:13150860-13150882 CCACCTGAGAGTGGTAAATAGAA No data
Right 950465478 3:13150903-13150925 AGTGTGAAAGCAGATGGTCCAGG No data
950465474_950465480 25 Left 950465474 3:13150860-13150882 CCACCTGAGAGTGGTAAATAGAA No data
Right 950465480 3:13150908-13150930 GAAAGCAGATGGTCCAGGGCTGG No data
950465474_950465481 30 Left 950465474 3:13150860-13150882 CCACCTGAGAGTGGTAAATAGAA No data
Right 950465481 3:13150913-13150935 CAGATGGTCCAGGGCTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950465474 Original CRISPR TTCTATTTACCACTCTCAGG TGG (reversed) Intergenic
No off target data available for this crispr