ID: 950465475

View in Genome Browser
Species Human (GRCh38)
Location 3:13150863-13150885
Sequence AATTTCTATTTACCACTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950465475_950465482 30 Left 950465475 3:13150863-13150885 CCTGAGAGTGGTAAATAGAAATT No data
Right 950465482 3:13150916-13150938 ATGGTCCAGGGCTGGCCTGGTGG No data
950465475_950465477 11 Left 950465475 3:13150863-13150885 CCTGAGAGTGGTAAATAGAAATT No data
Right 950465477 3:13150897-13150919 CATTTCAGTGTGAAAGCAGATGG No data
950465475_950465480 22 Left 950465475 3:13150863-13150885 CCTGAGAGTGGTAAATAGAAATT No data
Right 950465480 3:13150908-13150930 GAAAGCAGATGGTCCAGGGCTGG No data
950465475_950465481 27 Left 950465475 3:13150863-13150885 CCTGAGAGTGGTAAATAGAAATT No data
Right 950465481 3:13150913-13150935 CAGATGGTCCAGGGCTGGCCTGG No data
950465475_950465479 18 Left 950465475 3:13150863-13150885 CCTGAGAGTGGTAAATAGAAATT No data
Right 950465479 3:13150904-13150926 GTGTGAAAGCAGATGGTCCAGGG No data
950465475_950465478 17 Left 950465475 3:13150863-13150885 CCTGAGAGTGGTAAATAGAAATT No data
Right 950465478 3:13150903-13150925 AGTGTGAAAGCAGATGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950465475 Original CRISPR AATTTCTATTTACCACTCTC AGG (reversed) Intergenic
No off target data available for this crispr