ID: 950465476

View in Genome Browser
Species Human (GRCh38)
Location 3:13150874-13150896
Sequence TAAATAGAAATTTGTGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950465472_950465476 -7 Left 950465472 3:13150858-13150880 CCCCACCTGAGAGTGGTAAATAG No data
Right 950465476 3:13150874-13150896 TAAATAGAAATTTGTGTCTCTGG No data
950465474_950465476 -9 Left 950465474 3:13150860-13150882 CCACCTGAGAGTGGTAAATAGAA No data
Right 950465476 3:13150874-13150896 TAAATAGAAATTTGTGTCTCTGG No data
950465473_950465476 -8 Left 950465473 3:13150859-13150881 CCCACCTGAGAGTGGTAAATAGA No data
Right 950465476 3:13150874-13150896 TAAATAGAAATTTGTGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950465476 Original CRISPR TAAATAGAAATTTGTGTCTC TGG Intergenic
No off target data available for this crispr