ID: 950465478

View in Genome Browser
Species Human (GRCh38)
Location 3:13150903-13150925
Sequence AGTGTGAAAGCAGATGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950465473_950465478 21 Left 950465473 3:13150859-13150881 CCCACCTGAGAGTGGTAAATAGA No data
Right 950465478 3:13150903-13150925 AGTGTGAAAGCAGATGGTCCAGG No data
950465472_950465478 22 Left 950465472 3:13150858-13150880 CCCCACCTGAGAGTGGTAAATAG No data
Right 950465478 3:13150903-13150925 AGTGTGAAAGCAGATGGTCCAGG No data
950465474_950465478 20 Left 950465474 3:13150860-13150882 CCACCTGAGAGTGGTAAATAGAA No data
Right 950465478 3:13150903-13150925 AGTGTGAAAGCAGATGGTCCAGG No data
950465475_950465478 17 Left 950465475 3:13150863-13150885 CCTGAGAGTGGTAAATAGAAATT No data
Right 950465478 3:13150903-13150925 AGTGTGAAAGCAGATGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950465478 Original CRISPR AGTGTGAAAGCAGATGGTCC AGG Intergenic
No off target data available for this crispr