ID: 950465479 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:13150904-13150926 |
Sequence | GTGTGAAAGCAGATGGTCCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
950465473_950465479 | 22 | Left | 950465473 | 3:13150859-13150881 | CCCACCTGAGAGTGGTAAATAGA | No data | ||
Right | 950465479 | 3:13150904-13150926 | GTGTGAAAGCAGATGGTCCAGGG | No data | ||||
950465475_950465479 | 18 | Left | 950465475 | 3:13150863-13150885 | CCTGAGAGTGGTAAATAGAAATT | No data | ||
Right | 950465479 | 3:13150904-13150926 | GTGTGAAAGCAGATGGTCCAGGG | No data | ||||
950465474_950465479 | 21 | Left | 950465474 | 3:13150860-13150882 | CCACCTGAGAGTGGTAAATAGAA | No data | ||
Right | 950465479 | 3:13150904-13150926 | GTGTGAAAGCAGATGGTCCAGGG | No data | ||||
950465472_950465479 | 23 | Left | 950465472 | 3:13150858-13150880 | CCCCACCTGAGAGTGGTAAATAG | No data | ||
Right | 950465479 | 3:13150904-13150926 | GTGTGAAAGCAGATGGTCCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
950465479 | Original CRISPR | GTGTGAAAGCAGATGGTCCA GGG | Intergenic | ||
No off target data available for this crispr |